Description :
From Genome Similarity Track
Location :
Scaffold_38:163211- 165283
Transcript NameFunction/comments
Phyca_LT153484905cathepsin B, cysteine protease family C01A, putative
Phyca_LT1534535569transmembrane protein, putative

Sequence
2072 bases(100 bases per row)
gctaaatggacccatcacttgcggcattgcctgcagcgacgagttcgtattcaactactcggcaggcgttttccaggataaaactggatttttggacttg
accacgacgtggagattgtcggatggggggaagaagacgatggaaccaagtactggaacgtccgcaactcgtggggaacgtattggggcatgcagggctt
tttcaagatcattcgcggtgtcaataaccttggcattgaggccgattgccactgggtacgacctgatatttccgatgagaagctggttttctccaagaca
acaccgctttacgggggttcgctgtggggaattgtgccgtttgccaaggacgctgcaacatcacacccgatcaacacgacggcagatgttgtactcagca
acttgcctctgcagtctcaagagcttccagaaggagcggtgggggttattggacccaaaggtgatgcgtcgccaatggagaccgtgtcgttgcgcgagac
ggtaacggagaaaaacgcagtagaagaagtggaagaatctatcggtggggtggatgacagctttggattgtcgctcttcgcactcgcggcggtcttcatc
atgctcggaatgttcgtcagcaaattggtgacgcgtttttcgcggaacgagatgtacaatcgcttggtttagtgagttgtagcagcatttcaatgcagtc
ggatacacttgtattacaatgcacgcacctaccatttcgcattccattcgtgctgcggcaggtgcttaaaaaacttactttgaagtacttccatgccagt
gtgtttgatccatcgatagctcttctacagacgcacggtctcatcctttggtggagctgcaagtgccggtggctgtagctcccgcttggtgtccaacaag
tgcaggtagttggcctgcagtggagtcgatttgctcagcacaagctccgtctgtgccaactgctctctcgcctggcgcagctcctccgtcaacgcgtcat
aacgctctttatcaaacttcgacctggccatctgcttccgaaggcgtcgagtgtacacatagtggtagatgttctcgtactcgtattcctggttcgtgag
gctccaccaggcataaccgatgatagagacaccgaatcctgtgaagtacgtcacaggctccatgatatcccacgaaaagtgaatgaacgacagccagaag
tagaggccgaaggctccaacgagagacgttgagagtccgtacgcaatcacattcgcctgtcgggtagctgttgcctccaattcacggcgtaaatttacca
gagccacgtgctccggttcgagtgctcgaatcttggtcatcagcgactctctctgctgttcaaagagctgggacgataatggcgacaggccaatcgactc
caagtacgagtccaagatgctgcgtggttgtaagaacaccgaatgggtcaagtcttcatcgtccgacttgccaaagtaaaacaccacgcccgattgatgg
aaagtctgcagcacctcgggtgcctgtttcttggggattcctctctcgtggcacatctgcataaactcggggtggctgatcttccacttgcccagccgct
ccaagtcgctgcgtaacatgatgattgcagctttctgggccacggaacggacgtccaagtctccgtcatctgccagactttggtacgcactaccggtgaa
taccggggctcttacaggcaggacttggtcgttcagtaacaactcaaaatcatccgtcaagaccttctgcagagtatcctctggctggaattcttctcct
ctggcagaacgaatggctacactttgcacagacttgtcttcagcttcaatttgagcgataatatcagccacagtcgtctctgtaaaaataacattatcag
aaatcagaaaaaatctttaacgacatttataaaataatacataatacgaagagaatgatacctggagggatactaaagacccgctcctcatcgaacccgt
tgagaggcagaggaaccgccagcgtacacgttccatcgtggtatttaagctcaatggcgcgcgctttcccgt