Description :
From Genome Similarity Track
Location :
Scaffold_1069:1632- 3821
Transcript NameFunction/comments
Phyke_g11828hypothetical protein

Sequence
2189 bases(100 bases per row)
GATGAGTATGCAGAACGTTTGACGTTCGCACTCAACACCGCTCATGATCGCATCCGTGGTGACACACCGTTCTATTTAGTCCATGGTTGGGACCCGCGAT
CTACGCTGGAAGCCTCGCTACCCCTCGGTAGCACCCGGCGTAGAGACAGCGATCCACGAAGGTGGAGGTACCATATCCAACGTCAATATCAGCATGCCCG
AGAGCAAGTTAACGAGTCTCTACGTGACGCTATtcgagatcgagcagatcgacACAATGAAGGGGTTAATCTACACAAGGTTGAAGCGGGTATGCGAGTG
TGGCTATTTTTAGATCGAATGAAAGAAGTCTACGCACGAAAGCTCGCCCACATGTGGCGTGGACCTTTCCGAGTGATCGACATGGTAGATCGCTATGCTG
CACGATTGGAGATCGCTGGCACTGAGTACAGACTTTTCCCTGTTGTGCATGtctccaagctcaagccTGTTAAGTCTTTCCCAGATCGCCCTACTGTCGA
ACTGACGGTTGACGAGGAAGATCGTTTCGACTTCGATGAGGCCCTACTGCCGGAAGACAGTTGGGAGACTCAGCTAGGAGCGGACGAATTCGAGGTAGAT
CGGATCGCAGACGTGCGATCTGGTCGACGAACCCNACTCACAACGGGTTGGTCGTTGTGAGGAAGTGGTGAATGACGAGTCTGTGGGATGGCCACAGACT
AGAAGGAGGCGGTATTTGTAAATTGAGTGAAGGAGATCGAGTGGCCCGTGCCACTCAGATCAAGGCCCGTATTATGTGGCCGCATGCATATGGAAGGAGT
GATTGGATGACCTGAAGTTATAAGGAACCGAGATGGAGATAGTAGTGCTGACTACGAAGATATGTTAAGACGATTTAAAGGCGTTAAGTGAAGGTGGTTA
TCTCCTACGATAACTACCTACTACTACGCTGAATCACCGCTGTCCCCATCTCTTCCCGACCCGGACTTACCTGCCAGCCGAATGACACTGGAAGCCTCGG
TGGATCGAGTACTGGTAGTTGTGGTGGTCGCCGGACATTTCAAACTGGATACTACAACTGGCTGAAATAGTGAAGAACTGGATTGCACTTGGGAAAGGGA
CGAAGACAGTTGCACTGACAGAATCAGAGATGCGATACCTGCAAGTCGGTCTCGGATGTCATCACATTCACCTTGAGCAGCGTCACGGGCAGCAGTGAGG
AGAGAACATCTACGTTCTAGATCACTGCGATCTGTCTGTGCTTGCTTCAGATCGCCGCGGAGAGAAGCGTTATTCCGCTGTAATTGCTGCATGGTGGTCT
GAGATGTCCTTAGGTCTGTGACGCGTCGCTCTAAGCGAGCAATTGAcgaacgagcagcagtgagTTGGTCCTCTACGTGACAAACAACAGATCGCAACAG
TGTCAGTATGGTGATTATATGGTTCGTGTACATGGAGACGTACTGGTACCTTGATGATTAACAGACGCGCGATCACGTTGACTGGTcacttgctgaagct
tggTGTGCAGCCTTTGcagatcatcgtcagcagTTGTTGCACGCAATCAGAGAGCAGCGCATTCGGTGGAAAATCGATCGAGCTGAAGCTTGGTTTTGGT
CGCTTGGCGATCTAACTGGTCTTTTAGATCGGTTATCTGTCGCTTTTGGGCTGCGCTCTGTCTTTGCATCTGAGTCGCCGCATCTTCCAACGCTTTTTTG
CTCGTTTCCGTTGCTTGGAGATCTTCTTCCACCCGACATACGCTGTCAAGAGCTTGATCACGCTGAGTAATCGTGTTGGAAAGATCGCTCTCCAGATTTA
TGACACGTCGCGCTAATTGAGGTGAAGAAACGCTTTTGGAGCTCGAAACAGCACTTGCCGCAGCTAATTGAGCCTCCAGATCGTCGGTACGTGCATGGAA
TTCTTGGACAGCATCGTTGTAGGTGTCTTGCAATGCTTTGTATCGATCTTGAACAGCTGCGGTCTCTGCAGAGTTATCAAGCCGTTCTTGTAGGGTGCTC
ATATTGGATGACGGATGGAGAGGAAATGAGTgactgaagctgaagaaggagtgTGCACACGATCCCCACCGCTGTACGATGGTTCTCTGCGCAGGGGGCG
attgtggtgaagcctagtccatctttccggtgagaatggattgatggactgaggtaatctacggtgtgaccacatggactcaggTTATC