Description :
From Genome Similarity Track
Location :
Scaffold_54:163198- 164914
Sequence
1716 bases(100 bases per row)
AATGAGCCCACCGCAGCGCAGCGGAGGCGAACAGCCCACACTACACCAGCCAACCATGCCCTAGCGTCCGCGGAGCGGGCGCCCAGATCGCTAGTCGCTC
CGCTTCTAACCTTGTAGCATGCGACGGACAGACGGACGGACAGACCGTCCGTCCGTCAGTCCGTCGCATTCCCCGTCTTGCTGCTTTTACCTGCCTTTTC
GCATGGCTACACTCGGCCTGTCTAATACAGTTTCGTCCCATCTTATGGACGGCGCCTTTCTTTCTGACTCGACCTAACTATGCATAAATTACAAATATGT
CCAAAAGCGTCACACAATTAGCTCGCGCCCTGATTGGGCAATACCAGCCGACCTGCAACACTGACTGGATCTGTTGCACGATCAGACCGTCTCTCTTTGC
GATGGGACGTAAGTTAAACATTTTTGCCGAGCACGAAACGCATCGATTGGTTGCAAACAGCCAGGCGATCTGTGCAGATACTTGATTATTGACGCAAAAC
CTGTCCTATGTGCATATTATTCGGGCACGCGAACCACTGCTTTTTGTAGGGGCTTTGCAAACATTATTTTTTACCTCTCCTGGCACTCTCCACTGTCAGT
GTGCAAGAAGACGCGCGGCTGCACGGTCATTGCGCTATCTGCTCCCGTGCACCGCACTCGACGAATGCATGCGCGCACGGTACATAGTGTTTTTAGTCAC
TTTATTGCATGTAAAGTATGTATTTGTTTAAATATCTGATGTTATTAATATTAAAGCAAAGCCAAATATTAAATATCCTCTTTTTAATATTTTTTAAATA
TAAATACCAGCCTTACATTACTGTGCTATTAGCTAATATTTGACGCAAGTAATTGGTTAAAACAATATAATTTGCTAACTTACTCACAGTTTGCAAAATG
GTGGGCCCTACGTGCAAACAATGCGAGGGGAAGATTGACCCGCTTCTGCTGAACCCGCAGCGGTCTACGACGGATGCCCGGGCGCGCTGCGTCTGCTGCG
AGAAGCTGCAGTACGACTACGCATTCCGTACAATCAGCGGGCGGGACATCGTGCGGCGCTGTATTGCCTGCGAGAACGGCCCAAAAGCGGTTGAGTTCTG
GGGGGAAAAGCCCCCACCACCTGTTTCGGCCGAAGTACGCCGCAAGGAAAGCCTGGCGAACGTCAAGAAGGCGATGGGTCCTGAATGGTACCCCAAGGAG
AATAAGAGGCGCAGCCGCCCTCGCAAGCTGACCGCCCGAAACGCCAAGTACACCGAGCAAATGAAGCAGCAGAAGAGCTGGTAATTTGGATATACATCCT
TATAGCCCCTAGCCCCGCATAGTTTGTATACTGGCTGACGGTGCGAGGCTTGGGGTCGCACATACCGTAAGCTGACTGTGGCGCTACCAAGCGTGTTGAC
GCACCTATAGAGCGTAGCGCGTTTTATATAATAACTAGCACGAGGTATGTACTGTGTACCTCTGCAAGCTGGCCGTTCCTATCTGCATACGCGTCACCGT
AGACGGCAAGTACACTCACTCATTTGGCCACAAGCTTAATCATGCTATATGTACCACTAACGCTCACAGCCTATATTACACTTATGCGCGCTCGGAATTG
AAACTACAGTATTGAGTCGCACCACGCGCGAATAAAAGTTGCTGTCTATATAGACGTGAGGACGTGTGCGGTAATGTTGACCATACAGGTGTGCGTGGCA
GGTCGATGTATCTGTA