Description :
From Genome Similarity Track
Location :
contig_6:163164- 165114
Transcript NameFunction/comments
g2224.t1hypothetical protein

Sequence
1950 bases(100 bases per row)
CTGGGTGATTGCGTCTGGGTTGTTTTAGTTCTTCGACACGGAGTCGCCGGGCAACGGGTCGGCCACAGGCTTCGTCGTGGATGCCGAGAAAGGGATTATT
CTGACAAATCGTCACGTCGTGGGACCGGGGCCCATTGTACGCGAAGATGTTTTTGGGTAAAAGGGGAATAATTGTTGATGAGATGTTTTTGTGGGTTTTA
TTAGGACGCCGAAGCGGTTTTCCAGAACAACGAGGAAGTGCGCGTGATCCCCATCTACCGTGATCCCGTGCATGACTTTGGCTTCTTCCAGTTCGATCCG
GCGGTAATTTTGCTTTCGGTTGAAAGGGTGATGTTGGAGATATTTAAGTATTTTTTCTTATGGCGATCAACAGGATGTGAAGCACATGTCGGTGCCGTCG
CTGCATCTGCATCCGGACAAGGCCACTGTTGGAACGGATATTCGTGTGGTGGGAAACGACGCAGCCGAAAAGCTTGCCATTGCTAGTGGCACGCTGGCGC
GTCTTGATCGTGACGCTCCCAACTACGGCTTCAACAACTACAACGACTTCAACACGTTTTACTACCAAGCTTCGTCAGGTACGGTTTCAAGGAAGGTTTT
GTATCGCTCCGCTTGGGCTAGTTGCTTATCATTGCTTCTGGGTGGCAATGCTGCTATTGCAGGAACGACGGGGGGATCGTCGGGCTCTCCTGTGCTCAAC
CACGATGGCGATGCTATTGCTCTTAATGCTGGCGGCAAAATTGGCACGTCTGCTTCGTTCTACCTACCTCTTGATCGTGTAAAGAGAGCGTTTGATTTAG
TTCGAGAAGGTAAGGACGTGCCTCGCGGCACAATCCAAACAATTTTCAACTACAAGCCTTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACGGA
ACGGCTCGTTCGCTCGACTTTTCCGTTGGAGACAGGCATGCTGACAGTGGCAGAAACTATCCCGGGTGGCCCCTCAAACAAGAAGCTGCAGCCTGGCGAT
TTTTGGTTCGCGTCAATGGAGAGCTGATTACACGATTTGTGCCGCTGGAGGCTATTCTCGACGACAATGTTGGCGATGAGGTAAATGTGCCTATTGAGTT
CTTGCTACGCTTTTCCCCTGCAACGTAACATTGCTGACACGTGGATGGCAACATGTTTCGTAGATCGAGCTTCAGATTGAGCGATCTGGAGAACTGGTGA
CGCACAAGATGCAGGTGCAAGACCTGCACGCTGTCACCCCATCCCGCTTTATCGAAATCGGTGGGCAGTAATCAACCCACTGTCATACCAACAAGCTCGG
AATCATGCCATGAGCCCTGGAGCTCCGTATGTTGCAGATCCGGGCTACTTCCTGCAGCGCTCACGGATTGGTCGTGGTGCAATTATCCACTCGGTGAATG
GCGTGAAGACACCTGACCTAGAGACGCTTAAAAACTACCTAAAGCAGTGCAAGGACCGGGAACGCGTCGTAGTGAAATTCTCAAAACTGACGGACAAATC
GGAGAAAGTCGAGGTCGTGCATGTAGACCGCAGGTGGTTCCCATTCTGCGAGTACGTGCGCGACGACAAGCTTGGTACATGGCATTGCGAGCGCTTTGCG
CCACCCAGCAACGCGAATGATGATAAGACGGACAACTCAAGTGCCGATAAGCCAGTCGGCTCGACGACAACGCTGCCGGGCAAGAACCCAGTTGAGAACA
AGCTAGCGCGATCGTTGGTAACAGTTGACTTTGACCGACCGTTCAGCGTGAACAGTTTGTCAACGTCGAACTACCGCGGTACAGGACTTGTTATCGACGC
TGAGAAGGGACTTGTGGTGGTGGATCGCAACACTGTGACAGACTCGATGGGCGATGCTATGGTGACTTTCGCCAGCACCATCATCGTCCCAGCCCACGTC
GTGTTTGTCCATCCGGTACATAACTTCGCCATCGTACAATACGACCCGAA