Description :
From Genome Similarity Track
Location :
Scaffold_574:16316- 18402
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_574-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
2086 bases(100 bases per row)
TTTGACAAACCTCTGTAAAAGGACACCATGGCTACGGACGCCTGCACCTTGAACGGTGATGGGATACAGTGGATGCTGGTAAATTGGGATCAGATGTCCT
TAAAGTCAAAGGTGTCGTCGCGAAAATGACACGCCAAGCGACGTCGATAGCGTTGGTGCGTGTCAAAGGAGCCAAGCGCATCTGGAGACTTCTGATTGTC
CACGTGACGCAAGCGAGAATTTGGGCAACACCGTAATGCGCAAAAAATGTCAAAATAAAAAAATAAAAACGCAGAAGAATGCAACTCCAACGTGGCGTAG
GAGCATGAAAGGCCGCGCGTATCCCCCGTATCATCTCGCCAATGCGGACTGAACTCTTCGGCCAGCACGTTCGACTCGCGTCCCCACAGAATTCTGGGTA
TCAATCGACCGATCAGCTCATATCCCAGTGCTGCATGCGTGGCTCTGGTCACCTATTGGGGTGCGCCTCTGCAAAATCCATGGACGAGAGAAAACTTGCG
ACTGCCCATTACTCTCTCGAGATGATAGGCAAGTGCCTCCTTTCAAGACGGAAAAGTGCGGACCAAGCGGCCTTTGTGTATGCGTTTTCTACCGAGGAAG
GAATGAGGAGAAGACCAGGAGGTGCCACTCTCATGGGTGCTCGCTTGATTGCACCACCCAAACGACGACTTGACTTGCGCCACCCAAATTGTGATGAGAC
CTCCGAAAAGAAGATCACCGAGACAGGACGAACGAGGCAAGTACTGGACGCATGTGGATTTTCATTTTTGTTTTACTTGTCTCGTATTACACTCTTCCAT
TTGATATGCGCAGGGCACTAATGGACTCGTTCACTGGAACGAAGCAGCACGTGAGAGGCTCATTTAGTCCAAATTTCTGGTTTTCCTCTGAACATTTCGT
TCGTCCGGCAGCTGCGTTGACATTCGTCGCAAACACGTTCGACGGCATTGTTCGCGATACTGACACGCGAGACACGTGGCTGAACCCACATACAATTGAT
GTCAAATGATTCTGGTTTCACTCTCAAGGTAGGCCGACAGCTATAACCATACTAGGATGGAGTTCCATGGCTTCGTCTGCAATGCGTTCAGTTGCAGCAC
AAAAAACATCAGTATTTGTTCTTTCTTGGATCATTTGTACAGCAATTATAGTTTGCAGATCACCAAGAAGGTTTGCGTGACACCAGAACGAGTCGAGAAC
AGGATCTGGAAGCGCCGACGGCACGGATAGTGTTTCCATCGCAGTTGCGTTGACGTAGCAGCACTAGTGGATGTAGTGAGGCTGCGTGCCTATGGGCATA
TCAGGCCAAACTGATACTAGGAGCAATAAAGCTGCTCACAGTGTCGAGCCCATGGAACAATGGAGCAAGTGGGCGAGCCTGAAGGCACTCCAATAGCGTA
TTGAAGTTGTGTGTCTCTGCTTTCATATTTTTGTATTATTTCTCTTTCGCATACTATATAAACTCAACCATCTCCCTTCCCTTACAGCGTGGACAACCCA
ATGCCCTCGTAGCCGTTGCCACCGAGTCCCATGGCCTCAGCCGCGAGCGCCTCCTGCTTGTCGTAATTCGCCACGCGGCCACCGCTTTTACCACTCGACT
TTTTCGCATTCGTCGGCGATTTGCCAGGTCGCGTCACGTTCTGCAAAGCACATACAAAAACAAATAGAATGTTTGTGTATTTCGATAAGTACGCGCATAC
TGAAAAATGAAAAGGTACGTGAGTCCATCATGAGCGCAAAACAATAGCAAAAGACGTACAATCGGGACGCCGAGCTCCTTGCAGAGCGCTTCGGCCTCTG
CCCACTTGAGCACACCGTACTCGAGACACCACTTCTTGGCCATCTTGCTCTCTGGCCGTTGGTGCAGCAGGCTCTCGTAGAACACGCGGTCCGCAAAGCC
CTAGAAGCACACAGCAACAATGGCGCGAACGGTCGTGAGTGGGTGGATATCCGCCATCAATACGGAACAGCAGAGAAGGCAAAGATTCTCATAGACTGGG
GAACAGTGGACCGGTTTGATGCAGAGGTCCGCATGCTGGCTACAAAAACGTACGGGTGAGGGCGTCGGGTGCTTCTGGCCGGGCTT