Description :
From Genome Similarity Track
Location :
Scaffold_54:163104- 164915
Sequence
1811 bases(100 bases per row)
GAACACCAAAAACACCCTGAGTACAGTGTTTTAATCCAAAATGAGTATAACACGGTTTACATATAATTTATATAGCTTTGCTTTGAGTAAAAAAAATGAG
CCCACCGCAGCGCAGCGGAGGCGAACAGCCCACACTACACCAGCCAACCATGCCCTAGCGTCCGCGGAGCGGGCGCCCAGATCGCTAGTCGCTCCGCTTC
TAACCTTGTAGCATGCGACGGACAGACGGACGGACAGACCGTCCGTCCGTCAGTCCGTCGCATTCCCCGTCTTGCTGCTTTTACCTGCCTTTTCGCATGG
CTACACTCGGCCTGTCTAATACAGTTTCGTCCCATCTTATGGACGGCGCCTTTCTTTCTGACTCGACCTAACTATGCATAAATTACAAATATGTCCAAAA
GCGTCACACAATTAGCTCGCGCCCTGATTGGGCAATACCAGCCGACCTGCAACACTGACTGGATCTGTTGCACGATCAGACCGTCTCTCTTTGCGATGGG
ACGTAAGTTAAACATTTTTGCCGAGCACGAAACGCATCGATTGGTTGCAAACAGCCAGGCGATCTGTGCAGATACTTGATTATTGACGCAAAACCTGTCC
TATGTGCATATTATTCGGGCACGCGAACCACTGCTTTTTGTAGGGGCTTTGCAAACATTATTTTTTACCTCTCCTGGCACTCTCCACTGTCAGTGTGCAA
GAAGACGCGCGGCTGCACGGTCATTGCGCTATCTGCTCCCGTGCACCGCACTCGACGAATGCATGCGCGCACGGTACATAGTGTTTTTAGTCACTTTATT
GCATGTAAAGTATGTATTTGTTTAAATATCTGATGTTATTAATATTAAAGCAAAGCCAAATATTAAATATCCTCTTTTTAATATTTTTTAAATATAAATA
CCAGCCTTACATTACTGTGCTATTAGCTAATATTTGACGCAAGTAATTGGTTAAAACAATATAATTTGCTAACTTACTCACAGTTTGCAAAATGGTGGGC
CCTACGTGCAAACAATGCGAGGGGAAGATTGACCCGCTTCTGCTGAACCCGCAGCGGTCTACGACGGATGCCCGGGCGCGCTGCGTCTGCTGCGAGAAGC
TGCAGTACGACTACGCATTCCGTACAATCAGCGGGCGGGACATCGTGCGGCGCTGTATTGCCTGCGAGAACGGCCCAAAAGCGGTTGAGTTCTGGGGGGA
AAAGCCCCCACCACCTGTTTCGGCCGAAGTACGCCGCAAGGAAAGCCTGGCGAACGTCAAGAAGGCGATGGGTCCTGAATGGTACCCCAAGGAGAATAAG
AGGCGCAGCCGCCCTCGCAAGCTGACCGCCCGAAACGCCAAGTACACCGAGCAAATGAAGCAGCAGAAGAGCTGGTAATTTGGATATACATCCTTATAGC
CCCTAGCCCCGCATAGTTTGTATACTGGCTGACGGTGCGAGGCTTGGGGTCGCACATACCGTAAGCTGACTGTGGCGCTACCAAGCGTGTTGACGCACCT
ATAGAGCGTAGCGCGTTTTATATAATAACTAGCACGAGGTATGTACTGTGTACCTCTGCAAGCTGGCCGTTCCTATCTGCATACGCGTCACCGTAGACGG
CAAGTACACTCACTCATTTGGCCACAAGCTTAATCATGCTATATGTACCACTAACGCTCACAGCCTATATTACACTTATGCGCGCTCGGAATTGAAACTA
CAGTATTGAGTCGCACCACGCGCGAATAAAAGTTGCTGTCTATATAGACGTGAGGACGTGTGCGGTAATGTTGACCATACAGGTGTGCGTGGCAGGTCGA
TGTATCTGTAT