Description :
From Genome Similarity Track
Location :
Scaffold_276:16310- 18937
Sequence
2627 bases(100 bases per row)
CGGGTCAAGATCGCCGTTGTGTACTGCGGCCGCTCCACAGCAGACCCCTGCACGTCGGCGGGCTCAGGCACGTCCTTGGTAGTGTCGGTGGTTGCTTGGT
ACGCCAAGTTCTGCCACTCCGCGTACCTGCGAGATCCAACGGAGACATACCCAGGTGAGCGCGGCACTCGATCTCCGGCCAGCCACATCGCGAGTCGCGT
ACCCTGATGCAGCACTAACTCGCGATCGCTCACGTTTGTCAGTTGCAAGTAGCGGATCTTGTCCGGTCCACCAGTCACGGTAGGCACCCACCGATCGCCG
CGCGTAACCCAGAGTTTCTGATGCTCTGTTGATCTTGTGCGCAGCTTCACCTCAACGGATCCCGCTATGTCGATCTCGCGGTAACCGGTCAAGGTCACCT
GCTCCACCTTGTCTCCGTAGAGCGGACGTCTCCCAGCGAGCTGGATCCGCACTTCGTCTGGCAGGCAGATTGTCCCGTCGGCAAGAGCGAGGCGGATACC
CGCCGGTACCATGAAGTCCATGCCGATGATTAAGTCCTGACCGCCGGTCGGCGGACCCACCCAAACATCGAAAAAATACACAAGTGATCCAGCGAGCGTG
ATCTTGGCCCGTGCACGTCCTTCCGCCATGTATGGAGATTTTCCGACGCCTTCGCACTCCAATGTCTGACTTTCGTCAATGTAGCACCCCACCTTACGAG
CAAAGGCGGTGTCTAGGATAGACACTTCGGCACCACTGTCAAACAACAGAGTAGCTTTTTCGTTGTTGATCTTGCCCATAGCTTTCGCTTGCTTGAACTT
CTTGTCAGGCACATGGTATTTCCAGTAACCACGCGACTCCCCCAACGCGATATCCAAAGCCATCTTCACGCTCGATCTTGAGTAGTCATCAACTTGGTGA
AGACTTGACATGGCAGCCGTAGGTTTCTTTTGACGATCACATGTATTGTCGATGAGTTTGCTTACAGTCGACTGCAACTGCTTCTCGACATACGCAAAGA
TGCAGAACTGAGAACGCTCGTCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCCGCGGACTCGGGCAGCATGCCCCCGTGCTTG
GTGGGATTGTACCACTGGCGGATCAAATTGTAAAATTCCTCCATCGGACAGCTTCCTTCGTCGTGGATTTCGCCGTAGGCCTTGCAGACAAAGAGACAGC
GATCTGACGGGTGACCATGCTTGCCACATTTTTCACACGTCAGCCGCTTCCAGCATCCCAGATCGTCGTGTTTGGTAGACCCGCAATGAGTGCACCGCTT
GAGGGGCGGCCCCATGTCGATCGATTTAGAGAGATGTCCCGGTCGACGATCTTGACGGTCTCGATCTTGATCCGGTGGACGCCGATCTCGGCCGGCCGAG
CGATGTTCAGTCGTTCCATGATCGTTACTGGCTGAAGTCGCGTACACTCGGCGCAGATCTCCCTCTTCATCCGAGTCGCTGGATCCTGCATCCAAGTCAC
TGCTGTCGCTCTGCACATGAATCGCTCGTACCGCGCGAGCACCGGCGGCGGCTTGCGGCTTCGCGCGGGGCTTAATCGAGCCGTACACCGTCTTGCTCTG
TCGCGCTTAGGCACGCTGGCGAGATCGCAAAACTTCTTCCAGAGTGTCCGCGTCGGGAATCCGAAGCAGGGCAAGCTGGTCCGCTAGATCGCGGTCATCC
AAAGTCTCGATAAAGTGTTCCACATGTTCCCGGCGCACGTCTGGCGGTCCGTCCTTGACTTGTAGACGTGTCCGCAGGCCTGCGACGCTGAGCCTGTGGA
GGTACTCCAGAGGCGACTCGTCAGATCGTTTCCGAGCATGGTAGTACTGGCGGGCAACCGAGACACCACGCCCACAATACTGGACCTGGAAACTCTGGAG
CAGGTCTTTCCACGTGGTGCGAGTTGTTCGGCTCAGCTGCCTATACCAGTTTCGCGCTGGACCAGTGAGCAAATCACCAAACGCCAGACACTTCTCATCA
TCAGGCGCTTAATCGCAGACGAAAGCCGATCTTACCTTGCTGACCCAAGATCGAGCTCGATCTTCGTCGCCGTCCTTTCCGGAAAACTCCTTCAGTTCCG
ACATTGCACACACACGAATGCGTGGTGCGGTCCCAGTTCCTCCAGGCGAAGCAGTAGCCGTTGTTGCTACCGCCGCGCGGATAGGCCAACTGAGATCGAG
GTCGTCAGGATCAAACTCCCCTGACGCAGAGTGTCGGTTTGGTCATCCAACCGACTCCATCTCCACATCTTGATCTTCGGTCGTCGCGACTTCAGCGCGA
CACCAAGTAGCTGCTGCTCCTTCAGAAAACGTTCCATGGCTGCTTGGAAGAACGACTCGAGTCTTTCCGGGGAGTGTCGCACTGAAGTTGCTACGCCCTT
CGGCTCTCGCGTTGGCACAACCACCTCACGCTCAGCACGTTCAGCTCGACTTCTTAACATAGCGACACCGGAAGGGCCTAGCGTCATGCGCGGTGGCGGA
TCATCGACACTGTCAGATTCCACGTCTTCTGTTGCAGACACGTACGGAGATGACGTCGGAGTTTGGCCACCCGGATTGGGCGCAGGCGTCGATCTGGCGG
GTGTCGATCTCGATAGCGTCTGGGGCG