Description :
From Genome Similarity Track
Location :
Scaffold_1173:1631- 6579
Transcript NameFunction/comments
g10365.t1hypothetical protein

Sequence
4948 bases(100 bases per row)
TGTATCAGGATCCAGCGTTTCGACAGCACATACGAGCGTTTTACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGA
CGTCAATCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATT
GATCCCGCCACCGGAGAGCGCACGGACCCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATCTTTG
CTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAACAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTC
GCGAAACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAACTTGCCAACCGTTTCTGAGGTAGGCGCG
ACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATG
ATCCGCTTCAGTACCCTCTTCTGCTTCCATATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGAT
GTCCCTTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGAC
CAACGCGCTAAATGCGAGCAGGGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACAGAGGGCTTCAGGATGCACTGCTGAA
CGAAGGAACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGAGGTGGTGAT
ACCCATTTTCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCA
TTGTTAGAGAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGTCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGC
TCAGGACCGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGG
ATTTACGTGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCGCGTACTCGCCAAATCGTAGATC
GTATGGTGTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGGAAACCC
GTCATGCGCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGA
CGGCGTCGACGAGCTGAAGGCGTCTGATATGGAAAGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCA
AAAGTACAATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAATGGTCTGATAAAGCTGTGCTA
ACTGTCGAGACAGTTCGCGCGGGTGGAGAGCCCCCTCGTCAAGAGTCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCT
GTATCCGCTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTTGAAGATGCCCAAACCGTGTTCTTCAGAGCGAC
GGAAGACCCGGAGCGTGTCATTGGTCGTGGGAATCACACAATGTTGACCCGCTTCTTCGAATTGTGTGCCAGCGACGAACCCGAGAACCAGATCGCGAAG
ACTATGCTGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAACACGAAGTGCTGAGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGT
GCATGTTTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATCTCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGT
GTGCTGCGTCCCACGTATCGAGACGCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGA
TGCCGTACCAGCTGCGCCAGCTCTTTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCT
TGACTATGCGTACAGGAACCGAGAGATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGTTCAGTGTCAGT
GGGTACTCCGTCCAAGACTTTGACCTCCCTCGGCTTAGCGAGTTCCCCCACCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCAACGAGAGCTAA
CTGGATATGATGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACCTAAATGAGGATCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGA
GGACCCACAGGAAGGCAGGAAGTTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCC
GGAAAATTTGCAATCGCGGTCGCTTCCAGTGGGATTGCTTCTCTGCTGCTCATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCATTGAAGATAG
ACGGCGAATCTACTTGCAACATCAACAAGCGATTCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGTGCATCG
GCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGG
CAAATTCTCCCCGTGGCGAAGGGCGGCTCGGCTACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCATAAGGTGCGTCTGA
CAGAGAACATGCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCTGAAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGTTGGAGAGGGGAGACACGA
GGTACACAATGATCTGGGAAATGACTACATTAAGATTCCACGCGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCG
GGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACAGACGAGTACTTTGCGAGTCGCACCA
TCCTCACCACCACGAACGCGATAGTCCATCTTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACAGACTCAGTTGA
GGATGACGAGGACGGGAACATATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAATTGAAACTCAAGAAGGGGATGCCG
ATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACGCGCCTGCGAATCGGCGAGCTCAAAGATCATGTCATCCACGCCACCATGG
CGGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTAAGACGCAGGCAGTT
TCCTATCCAGACTGCATTTGCCATGACGATCAACAAGGCGCAGGGACAAATGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGT
CAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGA
ACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGGGACTTAGTGTCAATGCATGTGCACGAAATGAATACATTTGTGGTTTTGCATAGCGCGGTA
ATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGCGCATGCCTGTGGTTTGAAGTGAGTGTGCGAACCACGCGGGTGCAAACCCAGGACCAAGCAGTG
CATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTTCAAGTCAACAGTAAAATATACCGATATAAAGAATAACCCTGTC
ATAGTAAAAATAGTAGTGAAGTGAGCTGGAAGAGCGAGCGAACGGGCACCAACCAATCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTGT
GTACAGTATGTTGGCAGCATATGCTTATTAGTATTGTGTGAACTCTCACGTTTATTGCTGCCACGCTATTGGTCAACATTAACGAAATACCCGTAAAATA
TACACTACACACCGTACTATATACTATACACGGCTGTCCGTTATGCACTGTATACGTATTGTCGCTATACACGGCCGTCCGCTATACACTATACACTGCT
GTGAGCTATACACTGTTGTCCACAATACACACGACTGTGCGCTATAGACTGTTCACGCTATACACGGTTGTCCGCTATGCACAACCAGTAAACACATTTG
TGATGTAACGGGGTTACATGAAGAGTGTCCGTCACTCTTCTGAGTTGG