Description :
From Genome Similarity Track
Location :
Scaffold_19:163072- 172979
Transcript NameFunction/comments
g11834.t1XP_009514470.1 hypothetical protein PHYSODRAFT_470234 [Phytophthora sojae
g11835.t1XP_009514471.1 hypothetical protein PHYSODRAFT_471412 [Phytophthora sojae
g11836.t1POM62008.1 12-oxophytodienoate reductase [Phytophthora palmivora var. palmivora
g11837.t1hypothetical protein
g11838.t1RAW42018.1 hypothetical protein PC110_g1762 [Phytophthora cactorum

Sequence
9907 bases(100 bases per row)
CGCCTGCGTATCGCATGAAGCAGCTGATGGCGCGCACGAAGGACGCGGCGCATATGAAGCCCCACTGCATGGGGTCCCGCCACTGCGGCGGCATCAAGTT
CAGCATGGCCGAGCCGAAAGCGTTAGTGGACCTACAATCCTGATGGAAAACTTAAACTTACGATACAGCATGCATGCTGTATCGTAAGCATAATCGTAGT
TTCTGTCGCTGATTGGTATCTCGGTGGTCGACACTGGTAAAATACAGGCTGTTCAAGTTAAATTACGGCATGTATTACATCGCTTCCTCCATGTTCTTGT
AGTTGGTGGCGACGGGCGAGCTGAGATCCGACATATTGAGTCCGATGTGGCCATTTCTAGTTGTGGTCTCGGTGGTCGTGTTGCTGCTGCGTTTGAAGTG
AGCCTGCCACTCAATGGGAAGACTCGCCTGGTAGTTGCGTCCACTGGCGCCAGAGCGAACGGTGCCGCAGGCTCCGAGTCTCCGAGCGATGCGGAAGCAC
AAAAACACTGCAGAACCCAGGAACCGCGCCATGTTGAAGACGGCCACGACGTACGAGATGAGCTTGAGGTAGCACGAGCTCGACACGAAGTACGTCATGC
AGTACATCCAGACGGCGTTCGTCACGAGCCAGAAGATCAGCAGCGACGACCGGAAGGCGCGGAAACTGTTGTCCACGTCCTCTTTCTCCTCAGCTGCTCG
CTGCTTCAAGGCTTCGAGGCGTTTCTGCTGCGCCACGATTTCTTTCAGGTTTCCATTGCCTTGGGTCACCTTGGCCGCTGCGTGGCCTGCTGTCTCCAAC
CCCTTGGTGCCCCAGCTCAGATCGTGCAAGTTGCTGTACGCGTATATGCCCAATATGTTCTGTAGGGTCGAAATAAAACTCGGTTAGCAGACTAGAAACG
ACAGGACCATCAACCAGGTTAGCGTACCACAAACGTCGGCAGCATGAAGTAGTACTGGAGCGTACTCAGCAGCACCGAGAATTCGCCGTGGATGAAAGCA
GACGCGAAAACGAGGCCGATTGCTGTAGCCACGCCGCCCACCAATTCAAAGTTCGAGACACTGCAACTAGCGAGGTCATCTCGCGGATCTGTGACACTGA
TGTCTGCCACCAGGGCGTAGATGGAAATGACCGAGACCACGAGCATGACAAGGCCCATGAATACATAGCTGAAGGAGTAGAAAGCCGCTGTGCGCTTCTC
GGGACGATTGCCGAGCGCGAACACCACAATACCACCGACAATAACCAAGTAAATGCCGAGTACGATGGCCAGCAGCACAGGGTAATCGCTGTACAACGTC
AGTGTCAGCACGTAGTAGAACGTGAGGAAGAGGTTACTCAGCAAGAACCAGCTTAGCAAGTTCTGTACGCCCAAGTACACAAACTGTAACGTGAGCACAA
GCTTGCGTGACAAACTGTGGCCACTCTCCCTCCAAACCCGACTGAAGTTGCTAATCGCGAACAACCCCGCGAAGAAGGACCCGTTGAGCCATCGCCGTCG
CTGCTTGATGAGGTCCACCAGCGTTTCAGGGACATCAGTACGTGCAATAGCGTCCTTCACATAGTGCATTGTCCAACTGCGTCCACGCCGTGCCAACAAC
TCAAAGCACAAAATGCGGTCTTCTGCGAGATACATGTTGCCCTTGAACGGTCCCAAGTCCCGAGTCGAAGTCGTCAAGCTCTTGAAGTATTCAGGCAACG
GACCTACTCCCTTCTCAGCGCGGATGGCCTCGTACCGGTAGGCTGAAAATGCTCCAGGTAGCACACTGATGAAGCCCAGCACCGATTCGAGCGACTTGTC
CATGACGTTCGAGATTTTGTACTCAAAGTGCTGCGCCGCAATAACGGGGTTGAAGTAGTTCGGGTGATCAACAGCAATTTCACCTGCCACACCACCGATC
TGTGGGTTTCGGTCCATGCTGCGAATGAGCTTGAAAATGGAGGTCGGCCCAGGAATGGTGCCCACATCCACTAGCACAGTGTACGTCGGCAGAAGCTGTT
CCGAGAAGGCATTGAAGAACCACAAGTGCGAGTTTAGTTTGCCGGCATTGCTCTCCTTGAGCGCGAAGATGAGCTGAATCGGCGGATAGAACGATTCAAA
GTTGTCGTCGCGCACGAGCTGCACGGTAGCCTCGAACAAATGGAGCTGCACGTCCACACCAACGCTCGTGACCGTCATAATTTCCTCGTCAAAGGCGCCC
AACCCAGTCAAGAAGTCCAAGCAGGACGCACTCGCTTTCGTGCGTCCATCGGACACCACAGCTACCGCAACACTTTCCCACGCTCGATCCCCCCACTGCT
CGGCCATGAACTCTAAATTCCTTGCAATTCCCGTCAGTGTTCCCTGCAATTCGCTGCCTTCTTCGTTGTACATGGTAATGGTGATGAACACGCGGATCTT
CTTCCCTGCCTGCTCGATTCGCAGTTGAAAGCCATCGTCCGTAAACTTCACCGGGTCTTTCGTTGACACCGCAGTGTATCGCATGTGGGTGAACTCCGGA
GGCTGATTCAGCGTCGGTTTGCGGCCCTGCCACGCTTCTTGAACTCTCGGCACCTGCGTTCTCTGGATCTGCAGTTGCGGGGGCAGCGCCGCCTTGCGTG
CGCTCTCCTGCACTGAATAATACCATTCATCCAGCTCCTCCGCCCTCTTCATGATCTCATTCGCCTTCTCTCGAATGCCTTGCTTCAGCAACGGATCGGG
TTCCCTTCTGCCCACTTTGACGAGAACGTCTCCTGCATCGGTGTACAATTGAATAGCTTGCAACGGAGTGCCGCTGCGTTCTGCTTCTGCTGCTAATTGA
ATCAGGCGGAAAGCCGCTTCGTACGTCTCCTCCACTGCTGGATTGAGACCTGATTGGCGATACGAGAGCTGCCTCTCAATGGGCTGGTTCGGGTGGGGCT
CGTCCACGTAGGAGTGACTTGTGGGTCTTGTGTCACGCCAGACATCAACGTTATCAGGAGTAGAGAGTCCGGAGGACGCTATAGCGTCGTATTCCTCTGT
GCCACTGCTAAAGTCGCCTGCAGCGTCTTGTTCCAGCATGGACTGCAGCTCTTCCAGCTCTCCAGGCTGGAAGGTGTCGCCCCAATCTCGAGCTGCTTCC
TGAGGCTGAAGTGACGACGTCCTGGAGGCTCGAAGCGACTGCAGACGCGCGCGCAAGTCTTCGGTGCTGCGTCCATTGCTCATGACGGTGGAATTGGAGT
CTGGACACGGCGTTTGATGTGCGAATTGATGAATGACGAGAAAGGCGTAATCGCTCAATGGTGGTGATTGACCGAGAAAGGATGCAGAGAGATGCGGCTT
GGACTGGACACCAAGAAGGACAAGGAGGCGGTCACCTTGCAGCGAGGTGTTGCGTTTGATGCGCTGGTTGATAGAGTGAAGCTGAGCGCTGCTGCTGGTT
GAGGCGGTTTAGATGGTGCAAATCGCAGGCGAGAGCTCGACCGCGTATTGAAATTCAGCAGTCGATCGAGCGTGGCAAAATGGATACATGCATCTCCGCG
TTGGACACTCGCAGCGAGTCTCACCGGGAATATTGTCAATGCTTGTGGGTATGACGAGCGCGCTGCGCTGCGAACACGGGCTGAAATGCAGCGAAAGTCT
CTGAAGAGCTCAACAAAAGGCTATCTGGTCCCACGCTAAGCGTTACGGTCGACTAGGAAAACGCTTGACAAGCATCGGCGGTCTCTTTCACAGCGACGAC
TTGGTCTCGAGCGTTGGGTAGTCCGTGTAACCGCGCGATAACGGGCCGCTCGCCGGCACGTAGAAGGTCTTGCGGTCCCAAGGATTCCAGGGCGCGCCGG
CCTTCAGGCGGTGCACGAAGTCCGGGTTCGAGATGAACGGGCGACCGAACGCCACGCAGTCCGCTGCGCCGCTGCTCGTGACCTTGATACCTTCAGCACG
GTCGAACCCGGACGACGTCATGAGCACACCGCTGTACCGCGCGCGGCAGAACGGGGTCGTGCCGTCCTTGGGCACACGAGGGCCTCGGAAGTGGAACCCG
CGCGGCTCCACCATGTGCACATACGCCAAGTCAAGCGCGCTCAACTTCTCGAGGACGTAGCTGTACGTCTCGGTGGGGGTCGAGTCCGTGCAGCCGAACG
TCACACCAAACGGAGACAGCCGAATGGCCACCTGGCTCGAGTCCAGGCTGGACAGGACGGCGTCGAGCGCCTCTAGTATCAACCTCGCACGGTTTTCAAC
GCTGCCGCCGTACCGGTCGGTGCGCTTGTTCACTCCGTCACACAGGAATTGTTCCAGGAGGTAGCCATTGGCACCGTGCAGCTCGACGCCGTCGAAGCCG
GCGGCGATGGCATTCTCAGCAGCACGCTTGTAGTCCGCGACAACGCCTGGGATCTCGTGTGTCTCCAACGCGCGTGGCGTGACATACTTGCCTCGCCCCT
CTCGCGTGACAGCTGAGGTCTTGACGCCGCCCAAACCTACGGCGGATGACGACACAGGCAGCTCTCCGTTCGGCTGATTGAGTGGGTGGCCGACACGCCC
AGTGTGCCAGAGCTGCACGAAGATCTTGCCGCCTTTGTCGTGCACTGCCTGCGTGACCTTTTTCCAGCCCGCGACCTGCTCAGACGTAAACAAACCAGGG
GCCCCGAAGTAGCCGCGGGCTGTGGGGCTGATGTTGGTGGCCTCAGCGATAATGAGTCCACCAGGAGTGCTGCGTTGCGCGTAGTACTCGGCCACGAGGT
CGGTGGGGACTCCTTCCTCACCTGTGCGCAGTCTTGTGAGCGGAGCCATCACCACTCGATGCTGCAATTGCACGGGGTTCTTCTTGCCGCCGAGCGTCAA
CGGAGAGAAGAGTTTGGGCGTTGAAGACGCCATGGTTAGGCGGAGGAGAACACCTGCGAGCAAGACTGCAATTTGAGAAGTGAGACCAAGACACATCCAA
GCTGTTGTGCTTGTTAAACCTACTTGTTGACGTCAACCTCAGGATGCTACACACTCGCTAGCTCGCTTTTGGTACTTCTCAGGCCTTGGCAACTTCAGCT
TTCAACTCTAGCGCGGGGTAGTCCGTGTAACCTGCAGACATGGGCACGTCCGGTAGTGGGTAGAACGTCTTGTAGTCGCAAACATTCCACGGCGCATCGA
CCTCGAGTCGGTGCACCAAGTCGGGGTTGGCGATGAACGAGCGGCCGTAAGCCACGCAGTCTGCCAGCCCGCTCTCCGTGACGTCAATGCCTTCAGTGCG
ACCGAAACCGGACGACGTCATGAGCACGCCGTCGTACAGCTTGCGGCTGAACGTGGTGGTGCCGCCCTCAGGCACATTCTGCGCCGTCGGGTGCAGACCA
CGAGGCTCCACGATGTGCAGGTACGCGAGGTCGAGCGGGCTCAGCTGCTTGATCAAGTAGCTGTACGTCTCCTCAGGGGCCGAGTCCGTGCAGCCGAACG
TGTTGCCGAACGGAGACACTCGGATGGCCACTTGGCTCGAATCCAGGCTCGACAGCACGCCCTGAAGTGCCTGAAGCGTCAGCCTCGCACGGTTCTCGAT
GCTACCACCGTATTCATCCGTACGGTCGTTGACACTGTCACACAGGAACTGCTCCAGCAAGTAGCCGTTCGCGCCGTGCAGCTCAACGCCGTTAAAGCCA
GCCTCGATAGCGCACTCTGCCGCGCGCTTGTAGTCGGCCGCAATGCCAGGGATCTCGTGTGTCTCCAGAGGACGAGGGATGCTGTACGGACGTCTGCCTT
CCTGCGTGACAGCGACGCTCGCGGCGTCTTTGAACGGGAGCGCAGAGGACGACACGGGCTGCTCTCCATTGGGCTGATTCAGAGTGTGTCCGACACGTCC
CGAGTGCCAGAGCTGCACGAAGATCTTGCCGCCTTTGTCGTGCACTGCCTGCGTGACCTTCTTCCAGCCCGCGACCTGCTCAGACGTAAACAGACCAGGG
GCCCCGAAGTAGCCGCGAGCGGTGGGGCTAATGTTGGTGGCCTCAGCGATCAAGAGCCCGCCGCGGGTGCTGCGTTGCGTGTAGTACTCGGCCACGAGGT
CGGTGGGGACTCCTTCCTCACCCGTGCGCAGTCTCGTGAGCGGAGCCATCACCACTCGATGCTGCAATTGCACGGGGTTCTTCTTGCCGCCGAGCGTCAA
TGGGGAGAAGAGCTTGAACATCTTGGACGCCATGACGGTGGATCGACCAACTGATCGTCCGAGGGGCTGGAAATTGAATTATGGGGGACCTAGCTCAGCT
CAGCTCAACGAGAGAGGGAAATGTCTACAGGAACGGTGCCATTGGCACGAGTCTGAGCAGAGACTTTGAAGGCGAGGCGGTCTCGACAAGGGGAGCAGAG
CAGAGTGGGATCGCATGGCCTGGTCGAGCGCTTCAATTCAGCAGAGCATAGGCAAGCGATAGATATTCTTCCTGGTGCCCGAGCCATCTATGGGATCTCT
ACTCCCGAAACGTCATGTGGCCATGTGCAATACACTCCTCATTAGTGATATTACTGTTTACCCTTACTGGGTAAACTACCGGTATAGTAATACGCTCTAC
ATAATCATATTGCCCATCGTGTGGTGCGTCGATGTGCATGGCAGTTGCTGGCCGCTGTGTGCGACGCAGCTCGATACTGTCAACTGCATTAGGTCGCAGA
GGGTTCGCCGCCGCTCTACTGTCGAACTCAGCGCCCAAGTCATCGCGTGCATTCTCCCAGGCGCCATCAAACGGTAGCGAAGCGTTCCCCAACGCAGTCA
TCCACGCGTCCGCCAAGGTTTCGGCTGCTGTTAGCTGCGTTTCCTCAACTATTGCAATGACATTCACAACCGGAACGTGTCTGCTTCTCTGTTTTTGTAT
TAGATCGGCAGAGGGTGTCGCATTGGCGCCTTCAGCACCGTCGGGGAGGGGGTTGTCATCGGGGACGACACCACTATTGGGACCAATGTGACGCTGCAGA
ACTGCACCATTGGCAGCAAAGTGGTGCTTCATCCGGGGGTTTGCATCGGCCAGGATGGTTTTGGGTTCATGCTGGGGGCCACGGGAGAACACGCCAAGAA
ACCCCAGGAACTGAGTGTCGAGGTGCACGATCACGTCGAGATCGGGTACGTGCACTACCATAGACTGTCGGGCACAGATCGAGTGAACTTATGATTGCGA
TTGGTAGCGCGAACTGCACGATCGACCGCGGGAGCTGGCGCAACACAGTGATCGGCAAAGGCTGCAAGCTCGACAATCTGGTCAGGACAGGTGCCCATAA
GACTCGAACCTTTGATGTTGGTGATAGCTAACGATGCACCGTTTGCATGCGGGCAGATTCAGATTGGGCACAACGTGCAGCTTGGCACGGGCTGTGTGAT
CGCTGCGCAGACGGGAATCGCCGGCAGCACCACGCTGGGAGACAATGTGTACATTGGCGGACAGGTGGGCGTGGCGCAACACCTTCGCATCGGTGGCAAC
GTCCGCATCGCAGCGAAAAGCGGTGTCATGAACCACCTCGAGTCGAACGCAACCTATGGTACGATCCTGTCTGGTATATTGGTTTGAGAAGACTCTGGGC
TGACTATTAACGTTATTTGGTTTTACTAGGTGGATGTCCGGCAGTTCCGATCATGGAGTACCGCCGGCAAATGGCTCATTTGAGGCGTCTCGGCAAGAAA
TCTACCGACGAAAAGCAAGACTAGTGATTGTCCAGAGCACAATGAAAAGATTGGGAAAAGATGAATAGCAAGCTTCCATCGACGATTAGTTAACTAACGC
TGCTGAAGAAAAGAATCCTGCGATATTAATACTATGATGTGAAGCGTTGGCCCTGATCCACCAGGAATGCTAACCATTTGTGTCTATCTTGACGAGTTTC
CTTGGATATTGGAGTTGTACTTGGCCATCAGATACGTCGCTTCAGCCGCCATGTTGATCTGCATGAGGCGCTCCATCAGGTTTTCCTGATCAGAAGAGCT
GGTTGAAGAAGCCGTCGCAGTACCTGCAGAACCAGCAGACCCACCAACTTCCTTGGCGCGGAACGAGTTGATGTACTTCAGCTTGTCCTGCTCGAACACG
TCAACGGTCTCCGGCTCAGTCGAAGAATCGCTCCCGGAGTCCGAAACGTGGTTGATCTCTATCACATCACCTTCGTCAGCGTCGTAAAGGTTGATAAGTT
GCCGCCGCCGGTTGCTGCTGCTTGTGACCTGCACCTCCTCTTCACCAGAGGATTCCTCGCTCAAATCGCTCTCATCACTAATAAACCCGTGGCCGCGATA
TGTCTCGTTTCCGTCGACATCGTAAGTGCTGTCAATTGACTGGTTGCTCGTGTATCTGCTACCGTTGGACGACTGACTGGCCGAAGGAACCAAGCTCCGC
TGGGTTTGTATGCGGTTGTTGCTGAAGGCAGCGTTGCGGCGCAGCGAATCGCTTGGTGTGCGCTGGATCACCGGTGGCCCTGCCGCTGCGCGATTTCCCA
CTGACCGGCCTGCCGGTCGACCCGGCAGGGGCTGATAAACTCGAATGGTTTGGGCGTTGTCAGAGCTGCTAAGGTCTTCATCGATGTGACTGAAGCCTGG
ATTCAACGATGATGTCCTGTAGAACGACATCGACGGATCTGACGAGGTGGTAGCACCTCCACTGATGTAGCTGCTATTGCTGCTGCGCGGGCTCGACGGT
CGACCACCACGACCCCTGAACGGAGGCATGGCAGTCGATCCAACCTGATCGTGCGACGGCGCACGTCGACGCTGCACTGGAGTAGGGTCAGACGAAGACG
ACATCATCGAGAGACCCGGTCGTCCGGTTGATGGAGCGCGCGTGTGGCGAGGTGATCCAGACCGGTTGGAACCTGACCGCCCTGACGAATCCTCGGAGTG
GAAGCTCACGCGAGTGGTGGAACGTCCGTAGAGCTTCTCTTTCGCGTCGCTCAGGCACGGCTTGCAGAAAAAGTAGCTGCACGGGAAGTTGCCCGTACTG
CGCGAGGGGTAGATCATCTTGGTCATTCGGCAGCGGTCGCACACGTTCTTGCCGCAGATTTTGCAGTTTTGGTTGGTCTTAAGCATCTTGAGCTTCGAGT
CGCAGATATCGCACGTCTTACTCCTGTCAAAACACAGACTTGGTTAGTATTAAGCATAACCCCGGCAAAACAACAAAGACCACGTACGGTGAGCTGGTGA
TGAACATCTCCTTGCCGCTCACAAGTTTCGATAGTCGTTTGGCCTTGGCGCAGTCCAACACACTCGCCACGCCCAGCCACAGCTCCGCCATGATCGAGTC
CGCGCTCCACGTCCTCGACTTGCCTCCGACTGCATGTTGTCCCTTCATATACACCCCCACGCGGTTGTTCGGGAGCGGGCGGAAGATGTAGCATACCGCG
GCCGTCGACCTCATGAGTCCCTGCTGTTCAAACGGAGGGCACTCGTCCACCCTCACTGACTGCATGATCAGATACCCCACGTCGTCTCCATTGGCGTCGT
GTGTGCAGCCGAGCTCTTCGTGCCAGCAGAGATCCCGTTTGTGCACCAACTTGCCGGCCGGAGCGCTGGCGAGCCATTTGAGCCCCGCGAACTTGTACGA
GAAGCCTGTGTCGTCTTCGCTGTACGGGTCCTCCTCCAGCACATGCAGCACTGCTGTGTCCAGATAATCACTGTGCATGATGGCGCGCTGCGTCTTGAGC
GACCCGTTGGTGGTGGCGTAGAGACCCAGCAGCACGTCTTCGAGGGTGCCGGTCATTTGACCCAGCACGTTCACCTTGATGGCGTTGCCCTTCGCGAAGC
CTCGTTCTCTGTAGAGCTGCAGTCCGTTGCGGTCCCCGATGAGTTTCCACTGGTCTGGCTGCTGGCTGGGATGGAGCCGCGTCACAGGCAACTCGGCGTC
TAGCGTCTGGTGCAGCAGTCGCGAGGCGGTGTGGTGGAAGTCCTCGGCCAGTTGCGCGGACACGGCCATCTCCGGGAAGAAATCGTCCGGGAACGGCAGC
TTCACCT