Description :
From Genome Similarity Track
Location :
Scaffold_66:163052- 164215
Transcript NameFunction/comments
Physo_157884hypothetical protein
Physo_1387385'-3' exoribonuclease 2

Sequence
1163 bases(100 bases per row)
CAATGCTCTGCAGAACCGACTGCGGGAGGCGGAGCGCGAGGTGTATCGGCTAGAACTGCGGCAGGTGAGCTGGCTGGCTGAGATGCGTTATGCTGTGGAT
GGTGTGGTGTTGCTGACGATGATTTGATGTGGCTTGTAGCACAAGGTGCGCAGTGTGGTGTGGATGAATGTGCCGCTGGTGCTGGCGTTGTGCTGCTTGA
GCGCGTGGAGCTATACCACTGCAACTGATGAGGATGACTACTCAACTGGTACCGCTTCGGCTCAGCTTCGTGGGGCAGGAGATGGCATCTCTCAGTCCGT
GCAAGGCAATCCTGTGAAGAAGGTAGACAACAAGGCGGCTACAACTGACGCGGTGTTCGTCGTTGCCATGGCTGTGGTTTCTAACTTCCGTTGGTGCAGT
TTGTGCTTGTGACAGATTTACTGCTGTTGGTCGCTGTGATGATCTTGAGTGTGGGGGAGGAGGAAAGCACTGTACACGGTGGGAGTGCTTGCCGCCATTG
AGGCGGCCGTGATGCTGGCAGAGTTCGTCGCCTGGTCATCGCCTTTGCAAGTCTCCCATTCTGTCCTGGTGCTCGCGATTCTTGTGTTCAATGCTGTGCT
GATCACCAAGGAGAAGAAGGAATACCTCCGCGAGATGGCGGCGTTCTTGCCATCCTATTGAGTTTTTGCTGGAGAAGAGAGCTCAGCTGAATGAATGAAA
TGAACGGCAATGGTGTATTTCATGATAATTGCCACACAAAAATCAAATACCAACTCTATTCCCTGTTCCAATACTTGCGGACTACGAGTCGTAGTGCTCA
AAACAACATCCCGGCAGCCCCACAATCCCACTTGACACGACAGGCAATTGCGACCTACTCATCGGTTTGAACGTAGCATTCCGTGCTGCATCCGCTTCAT
CGTATAGCACCCCTGAGCGCAATAAATTTCTTGCCGTGGTCCGGAACAGCGTCTCCCTCAAATCTCTCTCCTCGGGTCTTTCTAGCGGCCCCTTGGGGCG
GTTCGCAGGGTCCTGTCGAGACTGCAGCCACTTGGCGTTAAGCTGTTTCCGCACTTTCCTCTCACTATGGCGTTTCAGCGCGCTCGCACCCCTTCCATTC
GCTAGTTCTCCACCATACTCTGTATCCTCACCGCTCCATCTGCTCTCACTCGCGGCACGACGA