Description :
From Genome Similarity Track
Location :
Scaffold_19:163048- 184231
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10225hypothetical protein
Phypa_INRA-310PPTG_10226hypothetical protein
Phypa_INRA-310PPTG_10227hypothetical protein
Phypa_INRA-310PPTG_10228hypothetical protein
Phypa_INRA-310PPTG_10229hypothetical protein

Sequence
21183 bases(100 bases per row)
GCTTCATTTTGACGTTGTCGATGCAAAACAACAGATCGATCTCTCCACTTGCTGACACTGCGAGATAACGCGAGCATTTCAGCCTTGTCAGTTAGCGCCA
TGATACGCTCCAGCTTCATTTTCGTGACTTCGATATACTCTCTCCATTTTCGGTATCCAGCACAAACCAATCGGTGGGTACTAAAGGAGAATGCTATCTC
ATTTTGTTCCTTTCGCACTTGCTTCATTTCCACCAGATCTTTCCATGAACTAAGAGATCGTCGAAGTAAAACCTCTACGGAGTAGTAACTGAGGACCCAC
TCCAGTTGTTTTTGCTTCTCGTGGCAAAACGTAATGTATCGTAGCCACGATTTCCAGGCCTTAGCTCGAAGATTGTCTTTGCACCAGATACTTGCTTTCT
CAGTTTCCACCCTCCGTTCAAATTGAGTTTGGGTGTACACAATCCACTTCTTCAAAATCATAACTTGCAAATTATCAAGTCTTCGGTGTTCCATCGCAAT
TATACACCTGCGCCAACTGACTGCCCGATTCCAACGAGACCACACCATTCTCAAGCATGAAACTCGGTACAATGCGTCGCTTTTGTCTCTGCGTGCTTGA
ACACAACGTCTTGTAAGCGTTTTCCAAGCACACAAATGGCGTGTCGTACGATTTCGAAGATGTGTCTGTTCGGCCAGAGTCCGTCGACATCGTTTGTTGC
GTTTGACAGCGATAAAGCGTCTCCATCGCCTCCAAAGGGATCGTATCCCATTGATTCGACCAAACATTGCAGCTTTCACGATTGCCTGCTGATATCTCGA
ATGCTTTCTCAAACTAGCTATAGCTCGTTTGCATTGCCACAGAGAATAATGGTCATCAGCTCTGTTCTGCAGAGATTGGTACTGTCGACGTTGTGAGGTA
AATAACTTCCATCTCACGAAAGTGGCTCGAGTGAGGTTATTGCAAAGAAGTTGGCTGGTCACCGAGATATTCTGGCGCACTCTTGCAACGTACTCGCGGT
GTAATTTCCAGTAGGCCCAAATTCTCCGAAGTAGAAGCCTTCTGCGATAAGAGTAGGCGAGAGTGTACAGAGTTCGCATGCTACGATATCCCTTCCACCT
TCGGAACGTAACACGACGGAGAAAGTTTGCTCTGTACTGGTCTGCTTTGCTACTCAGCACACTTTGAAACGTGCTAATCTTCGAAAAGAGTTGCCACTTT
TGAAACATTCTAAATAGTAACTTTTGTTTCCGCAGCCGTGATACAAATCTCCGTTTGGAGACTTTGTGGCGAACCTCCTCCTGATAGATCTTCCATAGTC
TCAAATACTTTGCCTGTACCCTCCTCGTGTAGAATTGATACGCTTTCATTTTCTTCGCTAGAGCTCTCGATCTGTTTTGGGAGTTTACGTGCCATTGGTA
TACTGCTTTCACAAGCCGATGGGTATTAATCTGCCGTGTTGTTGTCACTTCCTTATGCCGCAGAATTGACCTCTGAGACCAATTTTCTTGCCAGTGATAC
ATTGCGAGGCACGAAAGATACTCATTGTAGAATTTCTCTGCCATTGCAACCTGCTTACGGTGCTGCCGACGTTGACAACAAAACCTGGACCACTGAGTAA
AGCTGGTCTGCGAACGCTTCTGCTTCACTCTCCTGTGCATCACAGCAAGATTTCGTTGAATCTGAATCGCTCGTCTTGTTGATAGATGCCATGCTCGAAG
GACTTTTCCTTGCAAGAAGCTTTCATGAGTAACTCTTGCAGAAATTATTTTCTCGTTTGTTGCACGACGGGTGTTGAGAATTTCAAGCCACGCGTAAAAA
GAGCGGCGTTGGAGAGACTCCACGTTGAACTGAAGAGCAATCCATTTCTGTTGTCTACGGTGGAAACACTGTCGTGTAAGAGCGTACCAAGCGTACAGGC
AACGGGTGACTACTTTGTCGTCGCGAAGTTGCTGTCGATAGGCTAGAAATTCATCCCGTCGACGAAGATTTCTTGCTGCGATGCACCAATGATACAGTGT
TTTTATCATTATACGACGAAAGCAGTGCGACAGTGCCTTGCTCTGATTATTTCGAGCTCGTGACGCTCTTTTGGCAAAGCAAAACCACAGGTTGATCGCT
ACAGCGTATCTGCGTTCGTTATAGTATTGTTTTGCCACTGCCATGTTCATTCTTCTCTCTTTACTAAAACGACAGACTCTTCTCCATTCCGCAAGCGATA
GTCGAGCTGTATCCACATCTCGCTTACGAGTTGCAATACAGACGTGAGTATGAACTCGCCACAACCTGAAAATCGACCTGATGTGCTGTCGAGTCTGCTT
CTTTCGGAACAGCTTCACAAGCCGCTTGAAACATCTTTTTCGTAATGTTACACCCAACCATTCGCTAACCAAGCGTTGCAAAAGATATTCCTCATTTCGA
CGGCGCTGTTGCTCAACAATGTTACGTAGAGATATTTTTCCCGTGGTCCAATCGTGCCAAGCACGAAAATGTCTTGCAGTATTAAAATTCCGACGCTTTA
ATTCAAATGAGGAAATGAAGGAACGAATATGTAGCATTCTTAGCCATCTCTCCATGTATCGGTTCAAGATAAGATCATTCGTACGCTTCAATACGATGCA
TCGCTTTTCTTTTAGACCCTTGAGAGCTGTTATCTTTTCTCTCCACTCACGAAGCGCATTGTTCAGCTTCCTTGTACGGACAGAACGACGAAATATGCTT
ATCGCCGTATATTTTCGTGTAGTAGTGACCCACAGTTGGAATATTCTGGTAGCAAGCTTCCGTTTGTACCACCGAGTCGCCCTCCTCATTTGATCTCGTT
CAGCGCGATTAGCTCGGGCAAAGAAACGTAGGTTTTGAATGCTGAGCATTTTCAAACCCCGCTCATAATGTCTTTCCATCTCATCAAAGATCTGCTTGCG
ACGTCGCTTCATTTCAAGAAATTGACACCACGCTCGAATCGCACGCCGTACCGATATTCGATACCGGAAGAAATCAGCTAGCAGCACTTTACGAGCACGT
ACTTGACGTTCAGCTATATATTGTCTCCACTTTCTAACCCCACCCGACAGACTAATTCGTGTACCATTATCGATTGACCGAAGATACAATGGATTTTCAA
ATACTGCTTCTCTCCACCAACGTGTCAACTTGCTCAGTAGCTTCTTCCGATAATGTGAGGTGGAAACAACATGTTTCAAGTGTTCTTGTCTTGCTTGACT
AATTCCGTCTTGAAAGAATCTAAACATCGTGTTAAGATACGTATGACATCTCTTCGCCGCTAATATATGACACTTTTGTGTCTGTAAAATACATTGACGC
CAGTGTTGAAACACAAAACGTTTTCTCTGAGCTGTGTAGATAGTCTGTCTTCGCGTAATTTCACGTTCAACTCGACAGTATCGTTTCAAGTGAGCGAACA
TATCGCGTTTGATATGGTTCCAGTGGAATTTGTTTGCATCGTCCATGTGCTTTCTCTTCACTTTGTGAATGCTGACACCACATTTCCACGCTCGAATCGC
AAATTTCAGCTGTTGTCCACAGTGGAAACCATCGGCTTGTACGAGTTGTTGCACACGCTGCCTCCTGGATGTATCTGCATTGGATCTCCACCGATCAAAA
CAAGAATATACCAAACGTAGTTCCGCTCTAAACTGGCGACGCTTTTCGACGGACTGAGAGTCTTCAGAAGAATCGTTGACATCTAGAGAAATATTCCTCT
GTATGCCTGTAGAGTCCACACGAACGCCCTGCGTTTCGGGTTCAACCAAGTTTTGGATGCTCTTATTTGATTCTTCGGCGCTTGACACGCCCGTATGCCG
CTTAAGGATGAGATTTCGACGTGGTAGACGAAGACCAGTAGAGTCACCCCCCATTGAAATGGGATTGCTGGGTCGCGTGTTCATTCCATGGCGACGGATT
TTCTTTGCGGACCGACGAAGCGTAAACGCGACCCACTTCCACGCGGAGAAATGAGCTTCGATCACTTTCCTTCTCCAGTAAAACAAGGCAATGAACATCT
GCTGATCATCCTCGTCCATTGTGGTCACATACACCTCGTCAGAGCTCTCCGGTTGGGGCAAAGAGAACTGCTCAGTGATATCCCGGTGGTGCTTCGGAAA
GCGTGATGATCTTGACAGTGAACTGTACCGCGATGTCTGCTATCAACAACATTCCCACACTTCTTAGCTTGATACTTTGAGAAGTTCTAACAGTAACAAT
CTCACTGTGTTGTCCCGGTATGCTTCTACTCGCATTGGGTTCCTCGCTCTGTCAATTTTCCGGCCGGAACGCTTGCATTGTGCACAATCCAAAGGTGAAT
AACAATACTCAACCAGCTCGTAGACACCAAACCAGCGAGAAACTGTACCTGATCTGGAGCTCTCAGTTGATAAACTGGTCGAGTTCGTGTCGCTGCACTT
CTAACGTGCTCGACATCTTCGTCCTCAGAAGACAACCCTGAGGATGGCGGGGGCGTGTAATGATCCCGGACATCTTCGCGAGGATACCGTGACGTATGTA
GTTCAGGTGGTGTCGTCCGATTCGTCGGCATATCGTTGGTTTAATCCAGTAATGAGCCCGAGGCTTATGCGCTAGCGCTACCCAACTCGAGTACAGATAC
TGATCATGAAACGACGTGCCGCTTCAACGTGGTAACGTACATGGCATCGGCGCTAGTCCCTTGGCCTGGGCAAGATATCGCACATACACACCTTGGTATA
CCAGCTCGAATATCTGTGTCTGTAAGTCATCATAAATGGATGAGGACATCTTTTTGCCTGGAGTCGTAATCGCTTTCTTGATTTTCTTGCGCTGAGCTGC
TGTGATGACCTTAATACGGCGAGACTTGATGTAGGTAAGATAGATATTCACAGCTCTGGATAGGAGTGTCTTGCTGTCGATACCATCCTGAGTGGACAGA
GAGTTAATAGTTAGTCACAAATAATCTGAGCTATAGGGTAGCAGCTCCATACCTCTTTGAACTCCTCGATAGAGATCCAGAAAGTAACCATATCCTCAGC
GAATTCTTGTCTTGCAAATGCTAAAAAGCTAGCAAGGCCATCAGGATCCTCCATCATCAAGCGTCTGAAGCTCGCCAGATGCCTAGACAAAGATACCCCA
AAGATTCGCGTTAAAACGGACGTGAACTCCACAACGAGCAACAGGGGTGGCAAGGTTTGCAACGTACTTTTCGCTCTCGTTAGCGAGTTGTTCCATACGT
TTTCGATCCTGCTCGATCTTCTCCAGTGTGATATGGTCTTCCGTACTCATTTCTACTGTCTCCCGCTTTGAAATAAACTCGTCCAATTGCGCGAAGATTT
CTTTCAGACGCTTGTGGATGGGTGGAAGGGCTCGTGCACGGACATTGCATACGCGTCGGCAGGTTAAGACAGCCTTATGGTAATGCCCCATTACATCCTG
TAAACGAAGACAGACAAAATTGGTAATTGGTTCATAGGAGATTTAACTGACATTCTTACCAAGCTTTGTAGCAACATCGAAGTGGCTGTGAGAATGTCCT
TGTGATCTAGAGGCAACACACTTTCAAACAGTGACAATGCGTCTTCCATCATGCCAGCACATCTCTCAACGTCATCGGTCTCCTGCTCAAAGAATACCGA
TAAATATTATGTTAGCTGGCTTAGAAAATCATAAGAGAATGCTGAGTACCTGGGAGATCCGTGCCTTCCCAATGGCTACTTTCAGCATTGTAGGATGAAG
AATCCCTAGCGAGTCTATAGTCAATTTCTCCACTTTTTCAAGTAGGTCTCGAGCCTTCTCGTATTTCTTTTGTGTTGTGTACAAAACAGCAAGCTCGAGC
TCTGCTGGTTGCGTAAAGATCGTCCCTTCCCCTGCTTGAGCTGCATGCTTCGCCGCGACCACAGGCACATCGATTTGCATTTGTGAGATCGCTTTCTCCT
TCGCGATTCTTTTCCTACGTTGATACTTCTCAACCTCCGGGTCAACGGAGCGTGGCAACGCCGTAACGGGAGGCACAATGCCATCACTAAGCAGCAACGC
GCGCATTTCAGCAACGCAATTGGCACTTTTCACAATTGAGCGTTGGAGAGAATTCTCCTGGTTAGTTTGAACAACTTCCTTAAGTTCGTGCCCCACGTAC
AACTCAGGGCTCAGCTCTTCGTACTGATGATGTCGGCGATAAGCTAGTTCATGTAGACGAGCATGGCACTTATCACACAACACCTGATCACAAGAAATAC
ATCGCTTCCGAGCTCTGCTTAGTTGACAATTGTCGCAAGTAGGGAACTTCAGTCGCCCCGCTGAATCGGACGGTAATGGAGCAATTAACCCATTCCGACG
TCCACGGGCTCTAGTGGCTAGAATACGCTCTCGTTCCTTGTTAAATTGTTGTCGTCGCTTTCGATCTCGCTTCAAAATCTCTTGCTGGATGCTCCACTTC
CGAACCATAGGATCGTTTACAGGATCCTCCTCGTTTTCTTCTATAGGTTTCACGTCGTCAGTCCCTTCAATGGATCGGCAACCACAGTTACTGTCACTTT
CAAACGAGATATCTGCTTGTGCAAGTGAAATTGTGTACTCGGCCTCGATGAAATTTACGAGAGAAACAATATTCCCGAGTAATAGTCCAGAGTTGCCTTC
ACTATGTTGTTTAAGGTGTTTGTTTGTGAATTTGATCGCCAGATCCGGGTGGTCGTATGCGTTCAAGTAGTACAAGGCATCGCGTCCGGAGAAATCTCGA
GTCAAAATATTGCAGCCGCACTTCATTAGCAATTGTATCATAGTGATATCTCCACGTTTGCATACAATCATCAACGCGTTGACACCCTCGCGATTTTGAT
GCGTGGGGATGCAATTGTTCTTGAGACAATACACAATATCAGCGTACGTTCCGATACTGCAAATCACTAATAAAGGAGAATTCCCAGTTGCATCTTCATA
GTTCGGACTGAGCTGAAATTCTTCAGAGGACAAAAGGTATCGTATCCTTTCCAAGTCCTTATTACGCATAGCCTTATCCATCTCTGCCATACCTTTCTGT
CGTATAACTCGGTTTGTCGACAACGGGCTTAATACTTCCCCGTCTTCCTCTTCTTCCTCGGCTTTCAGATGCGCTAAAAGGTTCGCACTAGGTAGGGAGC
TGTTCAATGCTGCCACCATAACAGAATTACGGAGTTGGACCGCCCAGTCTAGCGTAGCTTTCCCGTCTAGGTCTCGATGTTCCTTGCTCGCTCCATACGC
CAAGAGAACTCTAAACAAATCGGTATTCCCAGAAATTGCAGCTTGGATGAGTGTAGATCTCTCGGTTTTATTCACGCCATCAACGTTCGCTCCACACTCT
AACAGCGCCTTAAGTATCTCTTCTCGCCCTTTGTCTGCAGCGAGAAGAACTGCATTAACTTGGTTCTTCGTCTCGTAATTCAAATCTACCTTAAACTCCA
CAAGGATACTTAGAGCAACGACATCTCCAGTCATTACAACGGCTAACAATGGAGTGATCCCGGCTTTTGTCTCCGTGGTTGGCGAAGCACCGAGTTCAAG
CAGCTGCCTTAATACTCTCAGCTTCCCTTTAAATATTGCAGCGAGTATAGGTGTGAACCCATTCTCGCTCTCGTGGTTTAACAGATCAATGTTTCGATTG
CCAGAAGTCGAGGTTGCTGGATCGAAAAGAGGCACGAGACGGTCCCAGTGTTGGTGATACACTGCGTTCTCAACTTTCTTTCGAAAACTAGAAGAGAAAA
AAGAATGCATCAATTGTGTGAGCTTATTCCGCTTAGCAGGGAGTGCATCCAGTCGTAGTTTGGCCTCGTCCGATTTCTTTAACGCAAGTCCCTTCTCAAT
GATTCGAGCCTCAAGTAAACGCAGTCGTTGTAACCCTGATACACCGGGTGTCGAGGCCGATACACCCAAAGCCGTCGTCTTCTTTCTCGTCTCTGATATC
AACTTGTATAACTTCAATTCTTCAAGTCGCTGGAGCTCCATTCTCTTCTGCTCTCCCTTGCGACGATACCAGGCTTCCATGACAGCTGACAAACGCTCTT
CTTCCTCCATTTCAAGACATCGTGCAGCCAGTTTCTGCTGCTCCTTCTCGCAAACTCCAGTCTTCCGTTTCTGCTTCTGAAGCTCGCGCTGCTGCCGTCG
CAACACCGACGTCTTCTTTTGCTCCAGGCGAGTGTGCGCTTCCAGATTTTCCATATTGTCAATGTGAAAATCGACGAAAGTGGACATCACTCCTATTTTT
GCAACTATATTAAGAGACTTTGATGGCAGTTACCTGCAGAAATTGATGGATTTACCGTCAGGAAGCATCCATGAAAGGCTCGAATTGCTGCATGGCTACA
TACTTGGACGCAGATTTGGGCGTTCAACCAATCAAAAGAGCGATGACGAGGCACTGCAACTTGCCTTTTGACAAAATGCTTCAGTCCGAGTCCGTCGAGT
TCCCTCAGTTGCGAAAATGACGTTCCCCAATCGCATCACCTACCTGCTGTGCTCCCGAGAGAAATCCCAGCAAACTGCGCTACTGACGGCTAGTGACGCT
CCTATTGCCAATTTCGCCACATTATGCCATGTGACGCCAGGCAGCGACCACGAGGAGAAGCCCAAGCTCGAGAACGACGACTACTCCGTCCACGACCACG
CGCTGCTACCGCTTATACACAAATTCATTGCCATGATCTCGCAGCCGGCGAAGCTCCTCGCTGCACTGGTAATCGACTGCGACGGCAGAACATCCAAGGA
AACGTTTTGGGCCAAGGCGGCAGCGTATCAGCACTCGCAACTGCAAGGGCTGTGCACCTCGTGGTATCGAATCATGGAGGACATTGACCTGTACGAACTC
AGTCCGGCGGATCTGATGATTTTGAAGGCGGCGGTGTATTACTGGAGGTTATGGCAGTACGTCTGCGCGTCATGCGTCGATGCCGTAGCCTCCATCGAGG
AGAGCGCGACAAGTCCGCCGCCCAAGCAGGAGTTGACGTCGTGGACGTCTCTGCTGCAGAAGCGCAATGCTGCGTCCATCTCTCCGCCGTTAGAAGACAA
GTGCTCGGACGCGCTGTCTCAAGGCATGATTCTATCGGGTGGCAATGGCATGGTCAAGCGTTCGCGCATCAACCGGAAGAGTAACGAGTTTCTCATCGCG
TGGTTCCTGGCGCACAAGGAAAATCCGTATCCGTCTCCAGATGAGCGCGTGGAGATCGCTGAGAAAACGGGACTGGCCGAGCAGCAGGTACGTAACTGGT
TTGCCAACATGCGTAAACGTCACTGGAAGCCCAACCGTGCCAACACTAAGAAGCCGCGCTGCCTCGTGGACTACATGCTGAGGCAGAGCGACTCCTGAAC
TCGAAAAAAGTATCTGTATCCCGTGCCTCTGTACGCCTTTGTAGTAACCTCTTAAAACACTAACACAAACTCCAATCTCGTCGTGCAAATTTTTCTTTGT
TTTCAGGTGTATAGTGCTAACTACGAGCAAGTTGTGTGGATTGCATCGACTTTTAGTCCTCGTCGAGGGTCGGAGCCTCGCCGATCTCACTCTTGACGTA
CTTGTACTTGCCGGAAGAGCGGAAAATATCCTTCTTGGAGCCAGACACGGGGGCAGACGGCAGCGTAGCAGGAGCCAGGCCCAGCGTCTCCTCCTTGAAA
GCGGGCGACAGTGCGGGCCAGGCCATCCAGCCGACAAAGATCGCTCCGGGAACGCCCCACGGGGCTATAACGGACAGAGAGGCGGTAGTTAGGACAAGAG
CACAATAGAAAAGAGAGCAGAGGAGCGTACCCAAGCCCGTGAGCTCCTTGGCGAGGTGGGTCAGGCGAGCAACAGACATGGTGGAGGACTGTGGGGGTTA
TGAATTCCGCGGGTGTGGGGCGTTTTGTGTCCTCAGCTTTTGTGGTCAAATGGGCTGAGCATTTTGGCCAATGAACACGAAGTACACAAAAACACGAGAT
AACTCATAAATAGCATATTGATAGCAGTTTTATAAAAATAATAATGCTATAAAAATATACAGTTTAAAAATTAATTCATTTTAAAACTTATAAAATAATG
AACGTTACAATTAGAATTGTATAATACCGCTAATTTAAAGCGTCGATTCGTGATGCCCCTTCAACATGAATTGATATGAGGTGCTCTTCACCGACGACAG
TCCTTCTGCTGCTGCTCTGCCTGTGTCTTCCTGCTGTTGTTCATGCTGACATCACCAGCGCAAGCGTAATACCGGTGTCTCTAAAAGCAGGCGCCGTCAC
TGACGTCGTAGTCACTTTCACGAGCGGAGTTGATGTCGAAGTCAGCGGATCAGTTCTGGTCGAGTTCCCCGCCGGATTCCACATCTCCAGCGGGACAACG
GTAGCAGTCACCACAGCAGGCAGCACAACAACGCTGTCAGTCGCGTCCGTGTCGTCGACGCAGTTATCGGTTCTGGTGGGGACGACGAAAATCTTGGCGG
GTGTGGCATTCGGGTGTTCGGTGACGGACGTAACCAACCCGGGAGCACAGACAACCAGTGACTTCGAATTATCAACCTACGACTCCAGTAATACACTTTT
AGAGAGAAATACGGCAATATCTGGTGTCGTTATTGCAATAACAACGCTGTCTGGCGCGACTGTGGCTCCCAACAGTCTAAACGCCGGCGTGACGGGGACG
GCGACGGTGGCGTTCACGAGCGCCGTCCGCTTACCTGTCGGTAGTAAGATCGAAGTGACGTTCCCAAGCGACTTCACGGTGGCGTCGTTGACGCTGTCGT
CGGCCTCGAATATCGATAGCAGCAGCACTGTGGCCACGTCCAGCTCCGTGGTAACCGTCACGATCGCGGGCAGTGCAGTGACGGCTGGATCCAGCGTCTC
GTTCAAGCTGGACGGCGTGACGAACCCAGGCGCAAAGACGACGGGTACGTTTGTGGTGGCAACGACAGACAGCTCGTCGAAGATTTTCCAGCAGGCGACG
GGGGTTAGTGCAGCGACCATTGTGAGCACGACACTGACTGACGTCTCCGTTGGTGTGGATAACGATATCGCTGGTGTGGTGTCAAGTTATTCTGTGGATT
TTAAAATGAACGTTGGTATTCCTGTAGGAGGGTATGTGGTACTACTGGTGCCAACCGATTATTCTCTCTCTGGAAGTATATCTTTAGTTGATTCGCAAGT
GTCGACCACGTGGACTGGAGTATTGGATGGACAATCGATAAAATTTAAGACCCTAACATCCTACTCTGCAGGTCAGCATAGTGTACAAGTCGAGTTTCTC
GAAAATCCAGGTAAGTTATCTGCAGTGCGATGCATCATACGCAAAGTATCTTACTCATCTATATGTTGTTGCAGGAGCATCTACCACCGGGTCATTTAAA
CTGTCTACGACCGATGCGAATGAGTTTCTTTTGGAGAGTGCGAGTTGTGCTGGTGTCATGATTGTATCGGGTTCAATTACAGATGCAGTGTTCACACCGC
AGTTGGCCCATCCTGGGATTGCGTCCCGAGTCGATATTTCTTTCACGACATCCGCCGGTCTTGCAAAGAGCAGTCTCCTGATTATACAGCTCCCAGGTGG
AGAATACGATGCAGCTGTACCGAGTCTATCGGTTGTAGTTGCAACGCCAGCTAGCTGCAGTGCTGCTACCTCGTGGAATAGCACGAACGCAGCGTTATTG
ATTTTAATTACCAGTTCGACGACCATTCCTCACGGTACTGTGGTGACATTACAAGTAACGGCGTTGGAAATGCCGCAATCGATACGGGCAACGTCTACCT
CAGCATCAATTGAGAGCTGGAACGCTAAGGGGTTAAAACTGGACAGTTCTAGTACATTAAAGCTCAGTGAGATTACTGCAGTCCAGAGTCTTCCTTGTAC
GTGGTCTACGGAGACCCCGAATCCTGGAATCACGTCAAATGCACTGGTAACTTTCAACACGAATGGGAGAATCCCAGTCGGTGGCAAAATTGTTTTAAAA
GTCCCAACATCCGATTTTTACGCCAACTCGACGGGAAATGTTCCCTCCATCGTGTTTAAAACCCCGAGTACAGTCGTTACCACAGCAACATGGGATGCCT
CAAACGCCGCACTTGAGCTAGTAATTGTAAACGACTCCATCCCTTCCTACCAAGTAGGCATTCAAGTGAAGATCATGAAGCTTAACACTCCAGTATCTGT
ACGAACTGCTTCGAGGTTACCAGCATCGTTGACGACTTTCGATCCTCTTGGGATTGCAATCGATGGCCCCAGTGTACTTGACATGGACGCTATCACAGCA
GGCTTCATTCTAGGCAGTCGTCTTTGGACCGCAGTGAACGCAGTGGCTGGTGTTACGAGTGACCAAACTATTGACTTTTTCATTACCGGTCGAGTGGATC
CTGGAGGGAAGTTTGAGTTCACTCTTCCTGATACTAAGTGGAGTATGGCCGCGTCTGATGTGGCGACGTTTATCTCACCAAATCTCAGTGATGTCGGTAC
GGTTGTGTGGGATTCTCCCACTCGAATGATGACTGTAACTCTGACTGGAACGAAATCTATCCCCTCATACTCTGGGGTTACACTACTCATTCGAGACGTG
TCCAATCCACCAAAGGAGACGGGAATTAACAACGCGTACCTCACAACTAGAGCTGCTGACAATAGTATCATCGATGGACCTGATACAATTTCGGTTATGA
CTATATCACGAGGAGCGTTAACAGGTGATAAATTGTGGACATCTATCACTACCACAAGTGCGAGTATGCAGAGCGATCAACGCTTGAGATTTACATTAAC
TGGAGCTCTGCCAAGTGGTAGTATCATTCTAGTTACGCTCCCTGCTGGTGGCTGGCGAATGGTAAATAGCGCGGCAGTGTCAGCGTCTTTTACTCTACCA
GCAGGAGTAACAGTTCAGTCAGTGAGTTGGTCTCCTATGCTTTATGAGTTGCGTGTTGTCACTACTGGGGATATGAGTGAAGGCACAGCGGTGGAGTTGA
TTGTGAAGGATATGATTAATCCCTATTCAAGCTCAAAAGCTGGTACCTGTACAGTAACAACGATGCTACCAGACTCCGGGGTGGTTGCGGAGTCCAAGAG
CATTATCGTAAATGCAATTACGAGCGATATGTTGCCTACAGAAGGTTCATTTGTATCGAGCGTTCCCACACCGGGAGTTCTATCCACGCAGACAATCACA
TTCAAAACTGGAGGAAAGCTCGAGTCAGGCGCAAAGTTTTGCATTTCAATCACGGAATGGACTCTCATGGCCTCAACTTCCGCCTCGTTAACTCTGTCTG
TAACGACACAGTCTTCTCCATTGGCAAGTGAGTTAAACGCAGCAACCAATACGCTTTGTATGCAGACTGCAGTGGCGATTGACCAAGAAACAATTGTTAC
AATTGTGTTGACGGATATTCTATCACCACAGTCGATTCGTCCGGAGAAATTTACGAAACTAGATATCCAAAGTCACCTCGGTGGAGATGTAAATACAGGA
TCGATTCGCATGAATGCAGTCACGAAGGGGAAGTTAACAGGTCCATCGACATGGCAGTCCTTAGTTCGCAGTCCTGGTCCAGTTGCAGGCTTGAGAACCG
CCGCGAACTTGGCCTTCAAAACAACCGGACAGATCGCTGCAGGAGGGTCCATCTTGGTGGAACTTCCGTTCGAATGGGTCATGGTATCGACGTGTACAGC
AACATTCGTTCATCCACCTGTGCGGGGGAAAGTTTTCTGCGGTCAGAACAACATTAGCATTATATTGTCGGACGATCTGGTTGAAACTACCGACGTTAAT
ATCTCGTTCACAGGTGTATATAACCCTCCTCTTGTGATGCCGGAAGGGGTTGCGTCATGTCAGACGATTGCACCAGATGGAGGAGAGATCGATGAGAGTA
ATTATATCATAACAGGAGCGATCGTAGCAGCAGTGACAGGAATTATTGACTCGGGTGATCATCTCACTGCTGTGGTTGGACTGACTAAGACTTTCGTCTT
TGAGGGATTAACACTGGCTGAAAACGACGTCGTAAAGTTTGTGGATGCAAGCACAACCAGCGACGCAAACTGTGGCGAATCAACTACAGGTCAATCAGAT
GTTGGAGGTGTGAGTGTAAAGTATTTGGGTACGAATCTAGACATTTCCGTCAAGTTCACGCAGTCGTCACAGGATGGAAAACCATTCGCAATTTGCTACA
AATTTGGTGACAATCCGTTCAAGTTATACTCGACGCTCAGTATAATGGTCAAAGAGATAAAGTTCGTGAGTTCGAACGTTGGATTTCACGATGTTGCAGT
AGCAGATTTCGTGAAAACTTGGACGTTTAATGGCAATGGGATTTCGGCTGGAGATCAGATAAGGTGGATCGATCTCGACGTCGCACAAAGTGCGTCATAT
ATATCAACACCGCCTGACTGTCTTGACACATCGACACTGGCGAAGTTCGCTGCTCTTACTTCTGGGACTCTAAATTCTCCAGAAGATGATTATACTCGCG
TTATTCAGCATAACTCGAATGTCTCTTTTGCGTTCTCAGTGGAAAACAGCGGCAAAAATTTCTGTCTATGTTACAAGTTCGGAAACGAACCATTCATGGT
CTACCCAGCTATTAAAATACAAGTTAATCATCTCCACAAAATAGAAACTACATCCACTGGAAGTGACGCGGTTGCAGTGGTAGATGCTCCGAAATCATTA
AAGTTTTTTGGTGATGGTGTAGCACTGAACGATCGATTATACTTCGTCGAATTGGGTAGTGTATCAACTTGTGAAGAAAGCGATATTGACAAATCACTGC
GACTACTACACTTGATCAACAACCAAGTGCAAAGCGTGGTTTTCATTGATGGTAACTTTGTCACTACTGTCAATTTCGATGCCACTGCAGCAGGAATGAT
GGTGGTGCCTTGCTATCAATTCGGAATGGAGTCGTACCAGCTCTACCAAAACATTCGACTGAAAGTTAAGACGATCAATCGTTACACTGGAACACTAGGA
TCTCCACAACTTGCGGTTGCTGAAGTTCCAGAACCGCTTACGTTCCTCGGGTTTGGCTTAAATGGTGGAGATCTGGTGCGATGGATCTTAAATGGAGAGG
AGGACTGCGAAAGTAATCTCGCTTCTTTGACGGATTCTAAAACGATGGAGCTCGTAGATACAATCACATTGGATAACAACAGTGCAGCACTTTTCAACTT
TACCAGCACGCAGAGTGATTTCAACCCTGTGCTATGCTACAAATTCGGAGAAGAGAATTTCAAATTGTACCCTGAAATTTCGATTGCGATCGGAACAATC
CGTGCCAAGTCTCCACATGCAGGAGCGAAGGACATTGCTGTATCAGGATCGCGAAAGAATTTTACGCTGCTGGGAACAAATCTTGCGGCAGGTGACCGAA
TAGGCTGGACAAATGTCATCGATTCGACTGTTCCTTGCTCGAATCTGAGCCTACTAAACCCGAATACGATAAATCTCGACAATGACTATTTGTCGTATCT
CACCAGCTCCTACACTTTCGGTGTCTCGCTGTCCTCTTTAAGCTCCGGAAAACGAGTGTATCTTTGTTACGGGTTTGGGCAGGAGCCTTTCAAATTGTTT
ACTGGAGTGTACTTGGATGTCAAGAGTATCACAAATATGCGAGCACTTGTTGGAAGCCCCAGCGTCGCAGTCGCCGGTGCACTCAAAACTTTTTTATTCG
ATGGAGACGGCGTGGCGACGGGTGATTTTGCGAAATTTGTGTCCGGTAACAACAGTGACTGCACGGATCCGGGTGTTACACTGATGAATATCATTAATGA
ATACGACGACTACGACGAGATGGCAATGTTCTTGTACGAAGTTTCAGTCAAAACTACTACTGGAAGTTTTCAAGTAAACGATGACACAAAATCTTCGGGA
TTAAATCGCGTCTTGTGTTATCGCTTTGGGGTGGAACCGTTCGTCTTTTACGAAAATTTCCATATTGACGTGAAGACAATTTGGAGACTTTATCAGACAA
ACTTAAAGGCGGGAGGGCAGAACGATGTAGTGGTGATTAACGAACCAAAACAAATGACAATTGATGGAGTTGGTATCAGTGTAAAAGATACACTAAAATT
TGTCAACACCGGGACAAATAGTAAAGATTCTGACTGTGTGGACCTACCAGCTCAAGGTCGAGCTGATCAACACCTTTTAGTAGCGACAGATCTGACTGTA
ACATTGCCGTTCGACTATGGATCGAACGGTAGCATGTGGGTCCTTTGTTACAAGTTTGATGATGAACCCTATCGACTATACCCTACTGTCGGAATTTCAG
TTAAGGAGATCGCAGCGTTGTTAGATTACACGTTTCAAGACATTGCCGGCTTAGGAGGAGTCGCGACAATTGGGCATCGTAAGCAGTGGAAACTTGTAGG
ATCAGGGATCCAGGAGGGGGATACGGTCAAGATCGTACCACAAAGTGTAATGTCGAGTATAGAATGTGGGAAAGCAGACGCCAATATCGCAACTGGGACA
GCGATTATGACTGTGGACAAGAAGATGACGTTTTCAGGGACTATTTCGGCCTTCCCAGCGTCCACCAGAGACGTGTATCATTTGTGCTACCAATTCCAGG
ACGAACCGTTCACCTACATTCGTGACTTTACTTTAACCACGTACGGGATCATCAGTCTAGACCGCAGTGTAGTACTTGAAAGTGCCACAACTACAGCTCA
AATCACTGGATTTCGTCTCTCGAACACGGACGAAGTGGGCTGGACTACGAGTTCCAAAACATGCAGCACATTACTTGGACGCACTGAAGTTTCGGGGATG
AAGGCTAACCTCTATTTCGCTGATAGTTACACTCTGCTTTACTTATGCTACAGCTTTGATCGTCAGCCTTTTGACATTTTCAAAACTGTGACTCTAACTG
TAGCCAAAACTGAAATCTGGACACCTCACATAGTGTCAATTATCGCAGATCAGACAGCAGAAATTGTCGTGTCGGGAACATTTGGAATTACGCAGGGCAC
AGATCAAATTGCGTGGGTTCCTTCCGACGTTGTGGAGTGCTCAGCTGCTGCTGTAACTTTATATGCAGAGGTGATGCAAACTTCGGTAACAAGTGTCACA
AAGTCACAGTCGATCATTCCTCACGCTGGCGAGGCTTCTTTCAGCGCGAAATATGTTGCGCCTAGTAGTGGCAGTGGGATCACAGCGTCCGATAGTTTTT
CCACTTGGAAATTATGTTACAGATTTGGAACAACGCCGGACTATATCATGTTTGGGGATGTGCTGTGTATGGTGCTGAATATTGTCGAGGTGCTGTTACT
TTCGATGGAAACTACGAGTACTGGGGCTGTGATGAAGTTCCAGTTCGACGGCGTTGGTATGCAAGACTTTGACACAGCGAAATGGGTAGACGCCTCCATG
GCTACAGGTGACGCGGACTGTAACATTTTACCTGCAATTGGAGGCAGTAAGACGAGTGACGTAGTGAACTCTCGAGCAACATTTACGTTCGCAGAAGAGA
GTAGCTCAATGGCACTATGTTACAGATTTCTAGGTCATTCATTCAAGTTGTACGCTGATATACCAGTCCAAGACTCGACTACGTCTCGCGCTAGTATTGG
ATCTGCTACCAACTACGATGAAGAGGCTGTTGCTGCAGTCAGTGACCAATTTACTGCCAGTCGAGACGTTGCGACGGTATCGTTAACTCTTGACAAAGAC
ATCAATGAAATACCGCCTGGATCCAACGCTGAAGCAGCTTTCAAAGCGTCTTTCATTACCACGATGGCTGTGTCTTTGGGTATCGACGCGTCTAGAATTC
AGATCAAGGAGCTTGTGGCAGGATCAGTGGTGGTCAACTTCCAGCTTTTGGCTTCTGATAATCCCGCAGATCCGTCGGTGAACGAGGCAGTGCAGGATCT
TCATAGTCAACTACTGGACACGAGCAGTAACCTCTTGACTAGCAGCACAGTCGTCGTAAAGAACCCTGCTACAGCACTACGTGCTACCGTCACATCAGTC
CCAGCAGCAGCCAGTTCATCCGTGGCGATTCAAGCGCTCGGATACCAGTCGAATGGACTCTTCTCGTTTGTAAGAAGCATCTACAGTATCACTGAGAAAT
CATCCAAGCTGGTGATTCCAGTTATTCGTCTTCAAGGAACATCATCAGTTGTGTCTATCGCAGTGCAAGTCCAGACGTTGGGGACTACAGCGGTTTATGG
TAAAGACTACGCGTTCTCAGATTCTACGACTTTCGATGCTTCCTTGATGTTACTTCATCTACGCTTTGATATCGGAGAATCCTTGGGCACAATTGAGTTG
GATATACTGGATGATGACGCGAAAGAGGCTCATTTCAAGCTCATTTCCTTAGCTTTACAGAGCCCATCGACAGCTGGAGCAGCACTTGGGTCGACAAAAG
AGACCGTGGTTCGTATTTATGATTACGGAGACGGAATATCAATTGCCAATTCGAGTTTTACGGTTAACGGTGACCATCCGGATGAACAGCGAGATGTTCT
GCAAGGTTGGAAGGTTGTTGCCAATGGGGAAAGCCCGTTGCGTATCGATAGCAACGGTATCTTTGCAGTTGACGATGTACTTGGTGAAGACGAGTACAAC
CAGAAGTGCGATCTTGCTGCTCCTACTGGTGTGTGTACGTACGCGTGTGAGTTGGGTGGAGGACTGACGTCTTCTGGTGGATTGGAGTCAAGTTACAACG
TGCTGTCTCTTAGTGGAGACGACTACGCTGCAAGTATGAACGGGGTAAGCGCCTTCCCGTCAGAGGTAAAGCACCTTTACTTAGCAGCTATATACTTGCT
CTTTTCTAACATTTTTTTCGCTTTTTGTAGGCGTTTACAGTGTCGCTATGGGTGAAGACGACGCAAAGAGATTCAAGCGCTTGTCTCTATTCATACGCCG
TGGCTTCGAAGACAGCTCCAGCTGTACCATTGGCATTGTGTAACCCTTCCAATTTGCAACTCTTTATCAACGCAGAGAGCGACGTGAGCGGGTTGAACAC
ATTTGTGAACATCAGTGACAATGCGTGGCATTTCCTCGCAGTTACGTGGAGCTCAGAAGATGGTCGCGTGCATGTGTTCGACAACGGAATGCTAGTGTTT
GATGGGGGGCCATATCGTGGCGGACAAACACTGGAGTCCAATGGATTATTTGTGGCTGGTCAACTGGTGCTTTCCAGTGCATCCAGAACACCATGTACTG
TTGGAGCAGAGGCTCTCGCGCAGAGTTACACTGCAACTAGCACTGGTGCGTTATTTGTTACAACTACAGAAGATGTGAGCTGCGATGTGGTGGCCAACAG
CGGCTTCAATGGTCAGATCCAGCACGTCCACGTGTGGTCACGGACACTCACACGCTCAGAGCTTCTGGGCGAGCTCTCTTGGCCACTGCGGGTCGTCAGC
AATGGCCTCGTCTTGGGGTGGAACTTCGATACCTCTCACTTATTGCTACACGGTCGTGTGGTCAATGATCTGTCGATGCAGGGTCATAGCCAGAAGAACC
TCGGTGCACTACACTGCAGCCAGCACAATACGTTCCAATTGGCATCAAACGTATCCAGTACTAGCACCAACCTCTGTCTATCTCGAGGTGAGGTTCCCCG
ACTGGATGCCACCTTCCCTTGCGGTCCCGTGTTCTCCAACATTTGGCACTTCTCGGCTCCTGCAATCTTCGTGTCCAAGCTGAAAGACGCGTATGGCGGT
CGTCTCCAATACCGTCTCCTCGCACCGAGCTTCAACGGGTCTCCACGACCTCGCCGTGGGCAGGTTTCCATCTTCAGCACGAATAGCGACGGCGTTGTGA
CGCAGATATCGGCTGCATTAGGCTCGTTCAATCTCCCTTCAGCCTCTCCCTGGACGTACTATTCAGTCGTATTGCGTGAAGACTTTGGATGGATCACCGA
GCCGGATGGAGACACCCTCAGTGCAGCGGAATTTGGTGCTGTGCTTGACGGCGCTACAGTGCTCTGGATTCGAGGAGATATCTGGGGCTACGACTCCAAT
GGACCAGGACAAGAAGTAGTTTACCTCAACGACGTCGCGCTGTATGGACGATAACAAGACAGGAACTAGAAATTTATTACGCAACTAAACAAATGTTATG
TTACCCGTTTCCATTCTAGTACCGGCGAGCCTTGCAGCCAGAAGTGCTGGTCGTTGGCGTGTCGTTGGTAGCAGGGGCATCGGTATCAGAGTTCTGGTCA
GTTGATGGCGCCTCAGTCGCTGGTACAGCGGTGGTCACGGTGGGTGCTTCTGTGGTCTCTTCAACTTCGCTAGCATCGGCTTCGCTAGCTTCGGCCTCGC
TAGCCGCATCGTCTTCGCTCGTCTCCGTCGACGGAGCCGCCGTAGTTACAGTAGGAGTAGCTGTGGTGGCCACGGGAGCTGGTGTGTTGGCTGACGTTGA
CGTGCTCTCGCTGCCCGTGCTGGAACCGGCGACGCTCGAAGTGGAGCCGAGGTCGCTGGGGATGCCGTTCTCGACCGTCACGCCGTTAAACGACAGTATG
TCCTGCTTGTCCGCCATTTTGACAGCACTGCCGTCGTTCGAGAGCGTGAGCTGACCAAAGTGGAACTCGTAGTCCGTGGGGACGGCTCCGTTGTAGGTCT
CGGTCTTGGTGAGTGCCAGGGCGTCGTCACCTTCACTGAAGTAGAGCGCCAACTCTCCCGAAGACACGGCGATGCCGAAATTGTACCAGGTCTCGGTCTT
GAACTCCGTCGACCAGCGGGTCTCGGTGCTGCCGCCAGTGTACCAGACGAGCAGTACCGGGTCCACGGACGCGTCGATGCGGATCTCGAACAGGTGCGAC
TCGGGGAAGACAACTTGCCATGAATACAGGTTAACGTAGGCCTCCTCCTTCATCAGACTCACGCGGAAGAAGGTGGTGCCGGCCGTGTTTCCAGCGACGT
CCTGCACCAATTCGGAGCGACGGAAATTAGTCTGACCGCCGAAAATGGCCTCGGAATCCACGGCCAGCGTGGCAACGCCCGTGTCGCCGTTGAAGGCGGG
CGAGCGGCCCTTCTGGGTGATGGTAACCCACTGGTCCGGGCTCACAGTGCCATTCTGGCGGTTGGTCAGGATATGCGTCAGATACTTGTCTGTGAGCGTA
TCGACAGCCAGGTCCTGGAAGGTGCCGTCCCAGGGCAGCGCCTGGTCGTCTGCGGCGTGGACGACGCTAGACAGCAGCGTCGCTAGGAGCACCATGCCGG
TCGTGAGGATCGAGTGGATGCGGGCCATTGCAGAAAACTGAAGAAGCTTTAACTGGTGTCGAGCAAAAGCTGCAATGATTAGG