Description :
From Genome Similarity Track
Location :
contig_30:163021- 167821
Transcript NameFunction/comments
g6543.t1hypothetical protein
g6544.t1hypothetical protein

Sequence
4800 bases(100 bases per row)
AGGCAAATCGTTCCTGACCCGGCGAAGTTTCCTCGCTGTAGCCTTGCAAGTACTACACAGTGTACTACACATGCATCTCACTCGGACCAATCGTATGCAT
GTCGGCCTCGGTGCCAGCGAGTCGATGCACGTGCAGTGTTGGCGATGTCAATTCTTGTCAACAGCGGAGCTCGTTGTTGTGGGTACTGGATCCTGGAGAC
CGGCTGGATATTCTGCTGATGGCACCACTCCATCTGGCTGCAGGTGATCTTATCGCTTCAAGCTCGAAGAGCGTTTACGGCAGAAAGAAGGCCCCATGGG
TAGGGGCGATAAATTACTTTGTTATAATACTCGGAGCCCACCGGCTTAGTGTCCGTAATCACCAACCTGCAGGAGCTCTTGTCTATTTCTATGGGGGCCT
GCTGTCCTTCACATGACCCGCTGTCGTTTGAGGGGGGCTGGACCGCACGGGATCGAGGTCATAGTGCGGCGCTCGGCCTCGACGGACTGGTACTTGGTCC
ACAGGCGGGTGAGCATAGCCTCCTCCTGCTTCCGGCGGATGTAGCTGCTGGACGGCGGCAGGTTGGCAACCGCGAGGCGTTTGGGGGTGGCCGGCGTGGT
CTCGGCGAACAGGCTCGGGTCCAGCTCGTTTAGGTACTCGTCGAGTCCTCGGATGAGCATACGCTCGGCGGGGCGGCCCTCGGTCGGTTTCTGTTGCTGC
TCGAGCTGTTGTTTGCGCTCGAGGAACTCCTGGATCTCCTCGTAGTAGCTGCGCGAGCGACTGTCGTGCACACCGAGCAGCAGACTCGCGTCCTCGTCGA
GCCCGCCGACCTGCGCACTGATATACTGCTGCACGTGGTCCATCTCGGCGCGGTACTGCTGCTCTTTGGCGGGCGACGCGAACTGCAGCGGGCGACGCAC
GATGCGGTGCACCGGCTTGGGCGGTGAGCAAATAGCGCTGCTGCTGCTGCTTGACATAGGCTTTTCGTGGCTGGTGGTCTGCAAATAGCGGAATGGACCT
TGACTGCGGTGGAGCTGCTCGGCACAGAAGTCTCACGGGTGTTACTATCGCTTCAAGGAATGGGATCGCCCATCACTCCGAGCCAAAGACGACGCGACAA
CATTAGGTACCAATCAGGTGTGGTGGATTCTTTTTTGGTTACCTACACCTGCAATATAAGGGTTTTCGGAAAGCTGAAGTGTATTGAACTGCCTAATCCG
TTTCACTCGAGTTCAGCAGGGTCATAGGAAGGTAGAGTAGAAGACACTCACTCCTGCGCTGCGTCATCTGGTTCTAAAAAATCGGGAAAAAATAGTCGAA
ATTTGGTCGCCGACATACAAACACCAAATACACCGCCCTTTCGAGTAAAACGACCGCGACATTCATCAGCAAAGCCCGCCGAGCTGGATTGGCGCGCAGG
ATACTTTTGCTATGTTGGTGGTGATCCTGGTCGCCTCCGTTGTCGTCGAGCGTGGGTTCACTCTCTTTACCTGGTTCACTCCTTGAGCAGCGCGAACAGA
TCGGATCGGGCGAGGTGCCAGCAGCGCGAGCAGATGGTTGCACCGGTTGACAGTCCCAGAACAGCGGCTTGAATCTTCGGTTGATTTCATGTTTTCAGCG
ATGGGACCCGCCGTTCCTTTCAGTGGCAGCTCCAGGCGCTCGTGGCAGATCACAGAGCAAAGTCACATACATGTACAAACCGTAGTTGAAGCGCTGCGTC
ATCGCAAAATGCCCTTGATTCCCACCGCTCGACATGTATTGGTCAAAACGCTCATCAGTAGCTATTTCGGCCAATCCGACACCACTAGATAGGAGAGCGG
CCCATCAGGTTCAATCACCTGCAGTAGCATGGTAATGCCGACGCTGGGCAGCGGAGCCGCAGAGCGCGCGCTGCTGGCCGGCGGCTTCCTGCTGCTCTCG
TCTACCGTGGCGCTGTTCTGCCTCGAGCGCAAGCGCCTCCGCCAGCGCGCGTGGCGCCAACGCCTCACATACAAGAAGCTGTCGAAATCGTGCGGATTTT
CCCTTCCACTTGTCGTTCCTTGTCCGCCTCTAACCGCGTCTGAGTTACCTGCAGATCCGACCTGGGCGCGTCCTTCGGCTTGGACATTGGTGTGAAAATC
CACTGCAGGAGCTGATTTGGCGCTGGACTGACGCTGTTTCCTTGGCGCAGGGGGAACACTGGCCAAGATCGTGTACTTCGAGCGCCACGAGGCCGGCAAC
GACAAGCGCAAGAGACCGCGCTCGGCGTCGCTGGATGTGGCTGCGGGGGAGATGACTCAGTTCCTGCGCGAGAACGAGTCGTTCGGACTCACGGGCGTGC
AGGACGTGCGGCTGCGGATCCACTCCAAGACGCTCAACGGGGTGCGTTGTTGCTCTGTGGCTGCAGTTCGTGGAGAGTTTAGAGACTTATTGGCTGGTTG
CAGATGTTCCACTTCGTGCAGTTCGAGAGCAACAAGACGCGGGAGGCGATTGAGTTCATTACCAGCAATGGGATCAACCAGTCCCTGCGGATTCTGCCAT
GTACGGGCGGTGGTGCTCACAAGGTCCGGCTTTGGATTTTTACCGTGGAAATTGGAGCTCACTGCTGACATCTCGTGTTCTGATGGTGGGACTCGTACAG
TATGGCCCTGCTTTCAATGAAATTGCGGGAATCGAGCTGGAAAAATATGACGAGATCGAGTGCACGATTCTGGGCCTGCATCTGCTGCTCACGACACTTT
CCGATGAAGTGTACACATTTGAGGTATGTACTACTCGGCTAGTTTGTAGCAAAACAAGACTAACGCGATCGTTCTGTTGCTGAGTAGGTCGTGGATTTTA
ATTCCTTGACGGCGTCACGGGTGAAAACCATCCAGACGGATGTGAACGAAGATGTGTACCCCTATCTGGTGCGGCTAATGTTCACAGTTACCACCCAAAC
CAAAAAAGCTAACTCGAATTGTGTTTTTGCTCACCGCCACAGCTTGTCAGTATCGGCTCGGGTGTGAGTGTGTTGTACGTGAAGGGGCCGGGTGATTATG
AACGTGTCAGTGGCAGCAGTATTGGTGGGGGCACATATTGGGGTCTTTGTCGGTTGATGACTCACTGCGAGTCGTACGACGAAGCGTTGGACTTGTGTGT
CCATGGCTCCAACAAATCGGTTGATATGAGCGTGGGGGATATCTATGGTGGGGCATACGGCAAGTTCAAACTACCAGCATCCACAGTCGCCAGCAGCTTC
GGGAAAATGATCTCGGTTTCTCGCGAAAGCGTGAGCGATGCTGATCTTGCTCGCTCACTGCTGGTTATGATCACGCAAAACATTGGCCAGGTTGCCTTTC
TGAACGCGACATTGTACAAGACCAAGAACATTTTCTTCGTTGGAAACTTTCTTCGCCACAACAAGATTTCATCGCGGACGCTAGCGTACGCAATCAACTT
CTGGTCTAATGGAGCAATGGAGGCACGGTTTTGCAAACATGAAGGTTATCTCGGGGCGCTGGGGGCGTTCCTTCGCCACGCAGAGGTAACAAATGCCCAT
GGCGAAGAGTTTGTTTCGGCAACACGAGGATCAAGGCAGTTGTAGTCCTGCTTGCGCGATTGAGGAGCGCCTCTGCAGCTCGATCGATGCATATCAAGCG
AGGGTTCAATTCAAATAGAATTGACGACGTAGACTTGCCGTTGAGTGCCACGGTAGTCTGCCGAGTTTTGTGGGCAAATACTGTGCTAAGCTTACTATCT
GTTAGGTACTACGGGTTATTCAAGACTGCACGTACCAAGACTGGTCTGGTGCGTAAGTAGAAGGACAGGCATGGCAAGTGGATGACGAAAAGCTCAGATA
TGATGGTCTCGTGCGCTTCGTTCACATGGTTAGAGAGGTTCCACCAAACGAAAACAGATCCTTTCATGCAAGAGCTACGCTCTTCATCACTAGCGTCGCG
CTTTAGCGCACCGATCCAAGTGATCAACGCCCTGAAAAACAGCACACAAGCGCCTGCACGCCTTGGTGGGTCATTCGCGTCTCGGTTCCGTGCAGCGACT
AGCCTGTCAAAACCACTGGTGACGCCACCGCTACCGAGCAAACTCGAGATGATGAGTGCCCGGCAAAGAGGTCTGCTGGGATTATGGGCCTCATCTTGGT
GGATTGCGCGTTGGCGATTATCGCTGAGTTCACGAAACGCATAGACATGACCTGGTGGTCGATCCTCCAAGCACTCGTGACGCAGCAACCTCTCCTTTGA
TGGGGTGAGTGAGTGAGATGGCAGGTGGCCGTTGTGGATCAAATGCGCCGACATCAAGACGATCGAGCCCAGCACTGGTAGTTTCATTCTGCAAGTTTCT
GCCAAGTGACCAAGCACCAACCCAGCCCAATCCACCATGCCGCTCACCGTCCCTGGCTTCCACACCAACACGCCGCTGGACGCGACGTTCGACAAGGACA
TTCGTGATCTGCACCTGATCTACGACTACGACGCCGAGTCGGAGGATGGCAAGCCGGAGAAGTGGCGCTACGAGCTGTGGTTCTTCTCGCACGACCGCGT
GGTGTACGCGATCCACGGCGGTCCGATGGCCGGCCGCACCAACTACCAGACGTGCTCGTACCAGTGCGTCCGCCCGGGCGAGTTGTGGCAGTGCAACTGG
CTGGAGGAGACGGGCACGATCGTGAGCCTGGTGTTCGACATCAAGCTGCAGAAGTTGACGACCATGATCGGTTTCTCGAAGGGCCACTGGGAGCACCCCG
TGGAGGCCCACGGCGACAAGCGCAACGCAGAGGACTTCGCTCGCTGGCGCAAGCTGGCGGACTACGGCAACCAGAAGGACCGCCTGCTGCTGTGCGAGCA