Description :
From Genome Similarity Track
Location :
Scaffold_145:1630- 3424
Transcript NameFunction/comments
Hyaar_Emoy2811056hypothetical protein

Sequence
1794 bases(100 bases per row)
AAAAGGTTAGCTATTTCATAACCTTCGGTAACGTAAGAAGGTGTTACAAAATGACAAGGAACCATTACAGTGACGCTCAAAACTGTGCTGTTACTATGTT
GTTGGACAACTTTTTTGAAGTCTAAACAAGACGAAAGGAATGACTGACCTAAATTCACACGGATAGGCATAACAATAACGGACATGCACTAGGGCGTTGT
TGGCATGAAGATCTTCCACGATAGAGGTAACATTCGAAATAAGTGCGCTTTATGTAGTACGGAATCGCCAAGCTAGCACGGCCGCACAATGAAAGGTATG
GTGACTACAAATGTGTACGAGATGTACGTTATGTAACAAATACGAGACGTGAAGCATGTGATATTGCTAATCGGTGTAATTTCTTTCTTGTTATTCGCGT
GTTGTACGATTAAATATGAAATATAAGGAATTTATTGTTAATTGTGGTAGTGCCAAACGTAAATTTATGAAGCGTATGATCAAATTGGAATGGTGAAGCA
TGTGAAGTAGGTGACTGCGGTTTTGGTTACTGATTGTGCGTAAATGGGTATGGAGATAATTAGAAAAAGGTGAAGGTAGTGGTGTCAATAACTATGATGT
TGCGATTCGAGCATGTTGCCATCGAGAGATAGCGCAGGACCATACACGATTTTAAATCTACAAAGGTTCATACCTGTGCTGTAACAAGTGCTACCACGAA
GCGATGAGATTTCCATCGCGAACGAATTGCAAGTGAGTGAGTGCGTGAGTTTAGTGGGCTGAACATCACAATTTACGGCATATTATTAAGGGAATTACAT
CAGAGTTCATCAGATGAGCAGCTTAATTAGAAGACCTACATAATTTATATGTGGAATCAGGATGCAGGTAGAATAAGCTCCGATGGATCAATCACTTTCT
AATATACCTTCTCCTACTCAAGTCGTCTACACATCCAGGAGGGTAATAGTTGATGTCTTCGTCGATCCTCGCTCGCGCTTCAACCTTTACGCCATTCCGC
ACTCGTAAAGCTGCAAAAGGCAAAATCCGCCACCATACCTTATCGCTAATTTGTAAGTTTACCAATTAGCGATAAGGTAGGTCGGCATATTCTCTAATGG
ACGTGCTGAAAGAGCCGTACTAAAATCGCACCTAGTTCGGCTTGAGTGTCGACCACACAGCGTGACGCACATACGCACGCAAACACACCGTAAAGTAGCT
ATCGAAAAGTCCGCCTCTCACTAGCGCACACTCCCTAACAACTTCGCCTTTTGGGCTCGCAATTATTTACTACGCAGTGCTCTTGAACACGTCCAGCGTA
CGGCGGAAATGTCCGTATGTCTTTCGTCCTCTCTCTCTCTCTTTCTCTCTCTCTCTCTCTCTCTCGTCGACGCTCTCGTTTATCGCCGTGCCCCAGTCGT
GAATCTGCGTGCAACAGCAGCGACCACATGTCGGACGTCTTGCTCGTGTTCTTGGACGTACGAAGGCCACACTCCCCCCTGCTCTCTCTCTACCTCTATA
ATGACGTCTTGCCTGTTGTTCTCCTGTATCTTATGCTGTATACAGATCTGTAGAACTGAATCAAGCATGACGCAAGCGCCAACCCCACGACGACGACGAC
GACCTCGTGAGTGCTCGTTTCTACCCACGGTTCAGTTCACTTGGACACTCACTGTTTGTCAATGACTCGAACTTTGGACGTCGAGAACCCGGTGCGACTG
CCGCTGCGTCATCACACAACCAAAACAGTGATACCGTAACCAGTTACGGGGCGGTGGGTATGGAGGATTGACAAGATAGGTGGGTCACGAGATT