Description :
From Genome Similarity Track
Location :
Scaffold_1914:163- 6154
Transcript NameFunction/comments
Phyta_totarag13857hypothetical protein PHYSODRAFT_341852
Phyta_totarag13858hypothetical protein

Sequence
5991 bases(100 bases per row)
gatCTTTTAGTGACTCGAAATTTCACCGTGAGTCCCAAGAAGATGTGAAGGTGAAAGAAGAACAAGGGGGTTAAGCGTTATCGAAGATCGGATCGACGAC
AACGCCGCCGAATAAAGCAAGATCCGCAGATCGGCAGAGTGCTGGGAGGAACCTGTCGACAGAAATCAGGGAGATCTGGAAACAGATCTTGAAGAGAAAC
CTCAACCTCCTCCCCTGGTCCCTTCGGGGACCCCAGCGGAACTCGATAAGCATCGAGACCCGCGAAACAAAACAGGGAAGGTTAAACCCGAACCGTACGC
GTTCATGACGGACAACGTGACCGCAAGCCGGCTAGTCGCAAGATCTAatacgaagaagaagaaaacgaagactacgctgaagaaaatgaaggcaTCTGAG
TCGGAAGGCGAAGGTCAGAAGGAATCTCCATTTGCATGGACCGAGCAGGAACTAGAGTTCGCGTTTCACCACAAGGCGCTACGCAACTTCTTACTCCAAG
ATCCAGTgatgaagatcatgaagGTATAGCAGATCGGAGATATGAAGGGACCAGTGTCAGCTCCGCCAGAAATGTCCAACAAGCTGACCGTAGTCAAGAA
CCTACTCCAGATGCTGAAAGAGGAAGGTCTAGTCACCGGTGCTTTCGATGCCGACGGACTGTTTAATCTAGACCTAGAGACCGTCAAATCTACTTCCCGA
GAACATTTCGCTAGATTAGCGATCCTGGTAGGCGGAAATGCACGGATCGAAGATCCAGAGATCTCGCCCCAGAGCATCACGACGGAGTGCCAGACTGGCT
CTTCACATTATGCACTAGCTACGTCAGAACCGGACGCTTATGGATCCATAAGGCCGCAACGCATGCCTCTCTCGGACCTTCCGGAGAAGCACTATTGATa
tctcgatctcgtgggAAGTCCCCGGATCGGACGCTGCCGCAACAGCAGAGGCCGCCACAGAGGCAGCCAAACCAGATCACGAGCATAACCTCGTCGGAAG
AACCAACAGGCAGGCTGGAATCGTATTTCCAAGCTGCTATGAGCCGATTCGTCAAGGAACAGCAATTCGTGGCACCAACCCCGGTTGCGACCACTATAAG
GAGTGTTGGCGCACAAGATGTGGACATGGAGTCGGTCGGATCATCAGATCATCACCCCGCTCTCTGGGAGTACGACCCCGATGATCTGGATGCCCCACCC
ACTCGTGCCGCAGTagctacagcaacagctggATCCGCGCTCATCCAACTTGTGCGGATCTCAGCAATCTCCGATCTGAAGGATTTCACCTGGAaagatc
aagatgaagatcggGCAAGAGGGTGGATCAGCAAGGTCAAATCCGCATTCTTGCGTGATCAGGCCTCCGATGAAGAAAAGTGTTTGACATTCGGAGATCT
GTTGACGGGGCCTGCGCGGAACTGGTACCGCCAGTTGAGCCGAACAACGCGAAATAAGTGGAGCGATCTACTCCGCATCTTCCAGACCCAATACTGTGGT
CTCGGTGTCTGAGTCGTGAGGCAATACTACCATGCGCACAAGGGATCTGACGCGACCTCGCTGGAGTACCTCTACCGACTAAACGTAGCTGGTTTGCGAG
CACGGTTGAAGGTCAAGGATGGTGGAGCGGAGGAACGCCGAGAACGTGTCGACCATTTCATCGAGACAGTTGGAAATCAAGACCTGGCTGATCAATTGAC
GTTGTTGCGACTGGCAGATGCCGAAGAGCTAGATGAAGCCCTACTTGCCCGTGAACGAGCCAAGAGTCGACTGAAGAAAACAACCTTTGGATCTAACAAA
TACCGACAGAAGGTAGCCGTACCGGCTtcggcagcaccaacaaagCGGGCGGTCCAAGTGAACCAAACCCAAGACTCCGAATCAGGATCTGACTCCGGAT
CGGACAGATCTGAGTCTGAGGGAGACTTCGACGGATTTTTATGACATCATGAGATAACCCGCCGACGGATTCAACCCGAAGTGGCGCCGATCCAGCTCCA
CAAGACCGAAAATTATCAAACCGATCGCCGCGAGAACCCAGgctgcagatccagcaggGCGGGTCGAACCGTAGCCGTTGTCCGCACTGTGGATCTCGTA
AGCACACAGATCTCGGCTGCTGGAGCCGTTTGATCTGCCAAAAGTGCGGGAAGAAGGGTCACCCGTCGGATcactgcttcttcgtgagTCGCGGATGTAA
AGAACTGCATGATATGGGAAAGTGCCCGATGGAGGAGTTCTACAATCAACTCCGTCAGTGGCACGATCCGACCAAACATGCTGGCATGCTTCCGGCTATG
GCTGAGAAGATGTTAAATTAGGACGCTCGTCAGGTTGGAATCTGATACGAGCCAAGCGTTGTGAGGTTTGCATTTATGCAtttgtggagaagaagtcggt
ATATCAAGTCAGTGGACAGCAGCTAGATCTACGCGATAATACATGTGATTTACATGAGAACGCACAGTCATGGTTGCAAGGCTTCGTCATGTAGATGAAT
ATGCAGATCCGACGTGATGATGTCtctggatctcctcgcgGGCGAGTCGCGAGGTTATTGGAAGCATCACGCGCCGGGCAAGTGGTTCAGACAAGCGAAA
GCAACGGGGAAGATCGACAGTGGAAAGGCGATCTTAATCTTAGACACCGGTGCCGAGGTGTCCATATTGGACACCGCCTTTGCTCGTAAGGTTGGGTACC
ATGTCGACACGAGTCAGAGCCAAGATTGTGTGGGAATTCGTGAAAGTACATATACGAGGAATGGCAAGACCCGAATCAAGAGCACGCTATCATGATCTCT
GGTTTATTTCTTCGATATCTGGGTGGGTGATCTGGCAGGCCAAGATGCTATCTTAGGCATGCAATTTCATGGTACCGGCCGGGATCCGGCTGGATCTAGC
CGTTGGGTCGATCTGCTTGCCGGACGAAGTGAAGATCCAGCTtagtggacgacgacagctccacaATGGCAAGGTGAGGTTCTTGAGGCTAGATCAGCAC
ACGCAGATCGGCATCGAAGTATCCGTGGAGCTTCCAAGGAGCCTCAGAACTTCCGATCAAGAATTTTTTTTGGGTCACTAGGGGAGATCGGTGGGTGCCC
ACGGTGGTCAACGGCCCCTGCAAGTCAAGATATCTGCAGATCACCAAAATCGGCGACAGGAAATTGATCCTTCAAGATGACGAGCGAATCGGGATGTGGC
TGGTAGGAGATCGTGTACCACGCGTCTCAGGATTCGTCTCTGTTGGATCCCGCCGCTAGAGGGAATGGCAAAATCTTGCCCTAGAGGCTACCACAGAGTC
GAGACCGGAGGAAGGTCAAACGgtcgacgtcgttgacgGCCCTAGTGTGCATCAGCCGGAGTACCCGACACCTCGCGCGATATTACGGAGAAATGACACT
ACGCCGACCCAACGTACATCGATCGGGTTGTTGAGAACCGAGCCCAGACACCGGCGTTGCTCGGAAGCCTCCCGGTGCGAGTGGACGAGCTTTCGGGGCC
GACGAGTCAGGTGATAGCAGGGGTGTCAAAACCAGATCCAGAAGGTAATAAGCCATCGGGTCAGATCTGTTGCCGGTACACGGGGATACATCGAGCGAAG
GGAATGATCGACCGCCTACCATAAGGATCACAGAGTTGCTCCCGGAAGACGTGCCAGCGACAGACACGGATCCCAGGTTGAAGCCGACAAATCACCCGAA
ACAAGTTGGTCTAGATCGACGAAAAGAGTAAGGTCAGGTTGAGGAGGAGAGGTCTGTTACCATGAAAGCGGAGATCTGTACGCCGAGGGAGTTCAAGGAG
AGTTGACAGTACTCCTGGAAGTCACCCTGACTACGGATGAAGTTACGATCGACGATATCCAAGTAGGAGATCCGGGGTTCAACTCTCTGGAAGAGATCGA
TTGTTTGCGGCGGAAGATCTGGAAGTATCGACATCTGCTCATCGGCAAGGGTAATGCGTTACCTCCCGCTACCTGAGGCGTTGTATGCAACATTGATGTG
GGAAACGCTTAGCCGATCGCCCAACACGTGAGGAAGGTAGCCCCGCAGTTCCGGGAAAAGTTGTCAGAGCTGATCAAGGGACTGCTCGCCACCAGCATTA
TTCGCCACTCGACGTATCCCTGGGCTTCCCCCATAGTGGTGATCATCAAGAAAAATGGGGTGGACATATGGATGTGTATCGATTATCGACTGGTGAATAG
TCTCACAAGACTTATGGTGTATCTGATGCCCCTGATCAACGACCTCTTAGAAGACCTGGACAAGATCTTGTGGTACTGTTCGCTTTACATGGTGAGTGGG
TTCTAGGTAGTGATGATGACGGATCGTGCCCGAGCAATTTCAGCCTTCACCATGCCGTTTGGCTTATTCGAATGGAATCGGATGCCTTTCGGCCTCAAGA
ACGCTCCTCAGATCTaccagcacttgctgaacAATGCACTGTATGGGTTCACTCGGATCTCGCGATCTGATGACGATCAAAAGATCAAAGATCCGTTCGA
AGCCTAAGCGCCAGAAGAACCGAGTCAACCATCGGTATTGGGACGCAGATCCTAAATCGATGACGTCTTAGTGACTGCCCGATGGTGGGATCAGATGTGC
GATCGAGTAGACGCCCTGCTGGAGACTTGTGATAAGTGGAATCTGTCGATCAGCGTGGTCAAGAGCTTCTGGGGAAGACACAAAGTAGATTATCTGGGGC
ATCGGGTGTCGAGTGTCGGGCTCGAAGCCAACCCCAAGGACTTGGAGGCGTTGACCGGTCTACCTTTCCCGGGAACACTCCGAGCCATGCAGTCTTTTCT
GGGTAGTTTGAATTACTGCAGCCGCTTCGTCGAGGACTGCGCAATTTATGCAGTGGTGTTGTATTACGGGAAGTAGACTTTGCAGCGATGACGAAAAAGG
GTAAGCGTAAACAGATCGAGAGTCAGCTACAACGCCCAATCCGAATCTAGACCAACCAGATCCAAAGACTAAATATCTGGAGGCGAATGGGTCCGACCCT
CGAGATCGAGAGGTGTCGGCGGTAGACGAAATCGACCAACGATGGATCCACGCTCACAGAGCTTTTGTGATCCTAAATGAAATCGCGAAGACGCCAATCT
TACGGCACTTTGACCTGAAACGTCAAGCAGTGGTGGTCGTGTACGCCAGTCACTGGGCGATCTCGGCTGCTCTGATGCAGGATCACGATAGGACGCATTA
TCCTGTCATCTTTGCAAGTCGAACCCTGAAGTCGAATGAGTTGAATTGCGGAGTGGTAGAGAAAGACGTGCTGGCCCTGCTGCGGATCTTTGATATGAAT
ATAATGTGCTGGTGGGACGGCCAATCCGGATCTTGACCCGATATTCGGCGTTAGCGTGGCTCTTCTAGTCTCCTTGACTTCAGGGACGATTAGGGCAATA
GGTAGCACTGCTGTCGCCGTGGACACTCGAGATCACGAAGTGTACGAAAGGGGAGGACGAGATCCTGGGGGCTGGCTGCCTGCATAACTCCTAGATCTGA
CGTGGATAAGGCCCTGATCTCGATCGCGCCGAAAAAGGAACCCCGCCGTCAGATCGAAGCCCCGATCCCTACCGTGAGAAGGGAGGAAGAACTCCTCGTA
GCGAGCTTCGACGGATCGGGTCGGGTCAAGTGAGGTGGAGGCGCGTTCAGCACAATCGTGTGAAAGCTGCCGGATTGGACGGTGGTCAAGGTCAAATCTC
TCTATACTGAAAGTTTAACAGTGAACGAGGCAGAGTACAACGGCCTTCTGTTGTGTCTTGATCTACTGGACGGGGTGGAATATCAACGTCTCGTGATCTG
TGGAGACTCAAATCTGGTGATCCGTCTGTGGCGatgtgactccgaatctcagggtcccagaccttgagctcagaccgctcagctctgctctgctcagact
tgggctgggcggagctaggcgaggcgtgtgtatacctcaacttgcaatcccttctcttcttggtccttgactacagctacgctttgaGCCC