Description :
From Genome Similarity Track
Location :
Scaffold_1754:163- 1652
Transcript NameFunction/comments
Hyaar_Emoy2814808myosin-like protein

Sequence
1489 bases(100 bases per row)
TACGCTGACGCAAGAAACGCTCGCGATACACTTAGCCATGCAATACTTTCTGAACGAGAATCGCGTGGTCTTTCAGATTCAGGTTTGCGATGGTCCTCCA
ATCGCTGCAACAGACTCGAGCTGAAGTAGACCTTCGTCGAGCCCACGGCGAATTTGGTGTTTTGCATGCTAGTAGCAATGTCGGGCACCAAATCCTTCAG
CAGACCGGCTACCATTTCCGAAGGTTCCGCGTCACGCAGTGCTGACGGGCAAATGATCTGGAAACGCTGCTGGAACTCGACAAGTGGCAAACGATTCGGA
AAGGCAGCACGACTGATGCGAATGGCAGCGATCACGCCAGCACAGCGCAGTTGCTCCACAATCATGAGGCGATCAAACTCAGTTGCACTCTTGTTCGCGT
TCGGCTTGATGCAGCGCACATACTGCGATGAGGTCTTGTTAATGGTCAGCATCAGTTCTGACAGTTGCTTACGGAACGCACCAGCGATAGTGTTACCCAC
TAGAAAACACTTTGGCGGCCTTCTTTTCCGTTCTTGCCGCGGCTGCTGCCGTTGCTTGCCTTTGTGGGCGTGAAGATACCTGAAATGACTTCGTTGTGGC
TACCAGACAACAGCTGCACCATATCCGTAGGCAGTGTGTCCTTGTTCTTCTCTAAAAAGCCCGCACCGTTGTACGTCACATCTCCAGCACAATGGTGGAT
GATGAACTCCAACGGATTGATCCGGTTCTTTTCAATGCTCGGGTGGTCGCTGCAAGCATCTAGAACCTTACTCACAAGAGTACTGTCGGTAGCCTGAGGG
CGGAGCACTTCCTCATTCAGCATGCTGACGATACCCATTCGACCCTCAATCAGGTCTAGGATCGGCTGATTGTCGTCCTCAAAACGTCACCAGCGTTGAC
GTCAACGGAATGCCTTCATCCACGTACTCTTGCTGCACATCCTTAAACATGTCACTGTTGAACTTCTGCTGCAGCTTCTCGTTGGCATAGTTGATGCACA
GCTGCTCGAAGCTGTTCTGGTCAAGCTTTCGAAACCAAAGATATCCAACAGATCAGTGTGCGTCTTGACGTTTTTCGAGGAGCGAATAGCCTTGTTGGTA
CGTGCACGAGCCAGTGCCAAAGCTTCATGGATATCCGACGCCTGTTTGGCGTTCAGCGGAATCGTGTACGACTCGGAACCAGCTGTAATGGATCGTTTCA
GCAACGTCGAGTGGAGTGCTGCGCTTTTAGTACACAGCAGCGCACCGACATTGTCCACGATCTCTTCCTTGCTCACGCGATTCTTTCCGCTGTCATTGCG
TTCAGCGCAAACTCGACTTCGGCCAGGTTCAAAATCGTGCCACGATCTCAAATATTGCATTCTGCTCGTCCGTGGAAATGCCAATCGTATCAAGAGCACC
CTGTGTTTCTTTCAAACACTGGACATCATCAATGCCCGTCAATTGAGCTTTCGTTCCTTCAGCCACGTACTTGCAGCTCGTGGCGTCAA