Description :
From Genome Similarity Track
Location :
Scaffold_3321:163- 1440
Sequence
1277 bases(100 bases per row)
CGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGCGTGACCTTTCT
CCGGTGATGGACTTAACTCTGGCAAAGAGGTCCTGCGTCGCGGATGCTATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACACACTAGCTA
CGATGCCTGACTCCGTAAGCAAACGTAATAGATCGTTGACTGCCACCAACTTGTTCCCCGTTTTCGTTGGTGCTCTTACCGGTTCCCTTGGATCGTCGAT
CTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACAAAAACTCGAGATCCTTGTCTGACCAGCTT
GACCTCGATCCAGCTTGGTCTCCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTACTTTCTCGTTTCTTCGACTAGCG
GGGTTGGGTTTAGGTACAGTGTTGGCTTAACTGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTGGACTTGC
GTCGAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGTGTTC
CTCCCGAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTT
GAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTG
CCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCG
GTAGGGCGGGATCTTGCTCTCTCGGTAACCTCCGAAGAGTTCAAGTGGTGAAGCTTGCGTGTCTTGGCGAGACGTGGGGATGAAGTGGAGCAGCAGTGGA
AAATCTTCACTCTGCGTCCGTGGATAGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCT
TGCGGGTGTGCTCCCTTGCCTTTGCGTTTTTCTTTGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG