Description :
From Genome Similarity Track
Location :
contig_6:162984- 164933
Transcript NameFunction/comments
g1791.t1hypothetical protein

Sequence
1949 bases(100 bases per row)
CTGGGTGATTGCGTCTGGGTTGTTTTAGTTCTTCGACACGGAGTCGCCGGGCAACGGGTCGGCCACAGGCTTCGTCGTGGATGCCGAGAAAGGGATTATT
CTGACAAATCGTCACGTCGTGGGACCGGGGCCCATTGTACGCGAAGATGTTTTTGGGTAAAAGGGGAATAATTGTTGATGAGATGTTTTTGTGGGTTTTA
TTAGGACGCCGAAGCGGTTTTCCAGAACAACGAGGAAGTGCGCGTGATCCCCATCTACCGTGATCCCGTGCATGACTTTGGCTTCTTCCAGTTCGATCCG
GCGGTAATTTTGCTTTCGGTTGAAAGGGTGATGTTGGAGATATTTAAGTATTTTTCTTATGGCGATCAACAGGATGTGAAGCACATGTCGGTGCCGTCGC
TGCATCTGCATCCGGACAAGGCCACTGTTGGAACGGATATTCGTGTGGTGGGAAACGACGCAGCCGAAAAGCTTGCCATTGCTAGTGGCACGCTGGCGCG
TCTTGATCGTGACGCTCCCAACTACGGCTTCAACAACTACAACGACTTCAACACGTTTTACTACCAAGCTTCGTCAGGTACGGTTTCAAGGAAGGTTTTG
TATCGCTCCGCTTGGGCTAGTTGCTTATCATTGCTTCTGGGTGGCAATGCTGCTATTGCAGGAACGACGGGGGGATCGTCGGGCTCTCCTGTGCTCAACC
ACGATGGCGATGCTATTGCTCTTAATGCTGGCGGCAAAATTGGCACGTCTGCTTCGTTCTACCTACCTCTTGATCGTGTAAAGAGAGCGTTTGATTTAGT
TCGAGAAGGTAAGGACGTGCCTCGCGGCACAATCCAAACAATTTTCAACTACAAGCCTTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACGGAA
CGGCTCGTTCGCTCGACTTTTCCGTTGGAGACAGGCATGCTGACAGTGGCAGAAACTATCCCGGGTGGCCCCTCAAACAAGAAGCTGCAGCCTGGCGATT
TTTGGTTCGCGTCAATGGAGAGCTGATTACACGATTTGTGCCGCTGGAGGCTATTCTCGACGACAATGTTGGCGATGAGGTAAATGTGCCTATTGAGTTC
TTGCTACGCTTTTCCCCTGCAACGTAACATTGCTGACACGTGGATGGCAACATGTTTCGTAGATCGAGCTTCAGATTGAGCGATCTGGAGAACTGGTGAC
GCACAAGATGCAGGTGCAAGACCTGCACGCTGTCACCCCATCCCGCTTTATCGAAATCGGTGGGCAGTAATCAACCCACTGTCATACCAACAAGCTCGGA
ATCATGCCATGAGCCCTGGAGCTCCGTATGTTGCAGATCCGGGCTACTTCCTGCAGCGCTCACGGATTGGTCGTGGTGCAATTATCCACTCGGTGAATGG
CGTGAAGACACCTGACCTAGAGACGCTTAAAAACTACCTAAAGCAGTGCAAGGACCGGGAACGCGTCGTAGTGAAATTCTCAAAACTGACGGACAAATCG
GAGAAAGTCGAGGTCGTGCATGTAGACCGCAGGTGGTTCCCATTCTGCGAGTACGTGCGCGACGACAAGCTTGGTACATGGCATTGCGAGCGCTTTGCGC
CACCCAGCAACGCGAATGATGATAAGACGGACAACTCAAGTGCCGATAAGCCAGTCGGCTCGACGACAACGCTGCCGGGCAAGAACCCAGTTGAGAACAA
GCTAGCGCGATCGTTGGTAACAGTTGACTTTGACCGACCGTTCAGCGTGAACAGTTTGTCAACGTCGAACTACCGCGGTACAGGACTTGTTATCGACGCT
GAGAAGGGACTTGTGGTGGTGGATCGCAACACTGTGACAGACTCGATGGGCGATGCTATGGTGACTTTCGCCAGCACCATCATCGTCCCAGCCCACGTCG
TGTTTGTCCATCCGGTACATAACTTCGCCATCGTACAATACGACCCGAA