Description :
From Genome Similarity Track
Location :
scaffold_60:162973- 165126
Transcript NameFunction/comments
g6714.t1hypothetical protein

Sequence
2153 bases(100 bases per row)
CTTTTGGCTCGCGCAGACTCACATGCAGGTAGAGCATGTTGATAATCGCCTCGTGCTCGTCCTCGGTCTCAGCGTGTAGCTCATTGTCCACAGTCACTTC
ATGTGGAATGTCGCGTTGAAGTCCGCCGATGGCAGACGATGAACAGCCCACCGTTCCGAGCCAGACGCGAGCTAGCTTCGAGAGGAACGGGTACCGCTTG
CGGTTATCGCGCCACCACTTGAATGGATCCGTTATACGCGCCTCGCGCTTCTGATGCTTGGTCAGGTACGCAGACACCTCATCCGCCACGCACATCCGCG
TCTCCTCTATGCGAACATCGTCGAGAGGAGGCGCTGTCTCCTCCTGCAAAAGCGTGCGCATCAGTCCTTGTGCAGGAGTGTCCTCCCGGAATAAGTCAAC
AGTCTCCTTTACTAGCGCTAACTGGCATCGCTCTCGCTCGCTCTCGCCGACATGCTCCATCTTCGCGTAGCGTGGATCCAAAAGCGAGCACCACATCATC
TCCGACAGCAAATCGTCGAAATTCGCACGTAAGCTTTCGATGACGCTCTTTTGAAGCATTACGAGATCACGGCTAATCTCCGTCGCATCAAATCCGTACA
TCAACCGGTACTGCTTAATCAGACCATCCAGCACGTTTTCCTGGTTTAATTGGTGCTTGGAAATCACCAGGCAGTGGATCATGAACGGGAGAGTTCGAGC
TTTGTCGCTCGTGGTGATCACCTGAACTTCGCGCAATGTACGCAGTAGCAACAGGAGGGCTTCCGCTACAAACCACATCTTCGCAGTAGGCTCGGGGATG
TTGTGGGCCATTTCTTCATCGTTTTCAGTGTCCAGCGATGCAAAAAAACGATTGATAGAGGGTCTCCAGACCATCAACTCGGTCAACAAGTCATACACCT
GCTCCCATGAAGTGCAATCGGTTTTCCGAATTTTCAAGCTCTCGTCGTCCCCACCAGTGATCTGAGCGCGCAAAAGCGTCTGCTTCACTTCCCAATTATA
ATCCAACGCGTCTGCCAGTGCCCTCAGATCTGCAATCACCCCCCAAACGTTGGATTGGGCAGTCTGTTTGGACCTCACGCTTGTGCCAGCGTTTGGCGCC
GCAGTCGTAGCGTTGGGATTGCCGAGATCCCGAGGTCGCCATATCCAGCGAAGAAGGGAAGTATGAACCACTGCCCAAATGTCAGGAAAACGCTTAGCTT
CGAGGGCCGATGCAACGTGACAGCTTATCTTGTCGTTATTGCTCAGAAGAAGTGACAAGTTGTTCTTTGGGAGCTGCCACTCCCGTAGAATCGCCTTGAG
GTGCTCACCCAAAGCGTCCGCACCGCCGTCCTCTGGAAACGGCACGTAGACCACACCCAAGGGTAACGTCGCCGACTCGAAATTCGTGTTCATGTGGTGG
CACAGCAGTGCAAGGTACCTGAATCTCCCACCCCAATTCGAGTCGTAGTGCGTTTGCCAGATCTCTGCGGAGAGCGAGAAGTGGCCCACCTCCTTCTGAA
CCTGCACCATGGTTTTAAAACGGAGATCTGCCGCCTTCTGCTCCACTATGCGGCACATAGTTGTTCGATCTGGTACCGTTGCTTTTCCTTGCGAGAGGAA
CTGGATCAAGCGATCGAAGCTCGCGTCGGTCACCACCGACAACGGTTGGAAGCTGCAGCACACCCACTTGATCATCAGGTGCATGGCTGTCGGGTCTCCA
TAGTACTCGCGTCGGGACATCTCAGGCCGTACCTTCGACGCCGTCCGGCCCTTTTTGGGCGCAGGCCCCTGATTATCGCTTGGCTCCATGGAGATGTCTT
CACCCCCCGACGATTCGGACGACGAGCGCTTCCCATTGCGCTGAGCTTGTTCCGTTGTGGCTGGAGCCTTCTCTTCAGTCTCTCGCATTGCCAGATAATT
CTTGAGCTCTCGCGGGTGCAGCTTTTGCATGTGGTTACGCACCGAATTGCTCGATCCTTTCCGAAAAGAGAAGGCCTCTTTGCACTGCAGACAATAGGCC
TCCGTGACGTCGTCGGTACTCCATCTTGTCTGGCCAGCGGGGAGAGTGCGGCCAGGGGGCGCCACGAGCTTGATGAACTGCCAGTACTCGGGGCGCCGGA
TGCGCGGACACTTAAAGAGCGTCAGGCCGCGGTGGTCCAAGGAGTTGCTCATG