Description :
From Genome Similarity Track
Location :
contig_15:162901- 166948
Transcript NameFunction/comments
g4175.t1RAW26726.1 hypothetical protein PC110_g16874 [Phytophthora cactorum
g4176.t1XP_009516884.1 hypothetical protein PHYSODRAFT_309888 [Phytophthora sojae

Sequence
4047 bases(100 bases per row)
AACATCGTATCGTACACAGACCTCTCTTTCGACAGGTTGGACGTCGCCATAGCGGAAAGCACGGCGCAGAAAATTGGGAGAATCAACGACATCTCGCCCG
TAATTTCGAGCGTGATCACCGCCACAGAGACGGCTCGCGTCGCAGCGCCTCCAAACGCAGCAGCTCCAGCGAGGGCATACGCGCCCGGAGTAGCTCCGAT
GCTAGGGAATACGGTTGATAGCGCTTCACCGAATAGCCGGCCGAAGGCAGCGCCGCCGATGAATGTAGGTACCCACACACCCGTCGGCATCTTCACCGAG
ATGCACACTGGCAGCAAAAACATAAAGATCGCTGGCAAAACGGAGAGCGTGTAAAACTTTGACAACTTGTACCAGGAGTCTGGGAGATCCGCTTCGGTGA
ACAGCGTCGACAGCGTGTAAATCGTCGTGCTATGCGCAAACTCGCCAGGAACGTAGGTTAGAGTTCCACACAACACAGCGACGGCCACAGGATCAATCCA
CTCAACGAGTACTTTTTTCCAAGTCCGCGATGACTTGCGCAGATCTCGTCGAGTCTCAGCAACGACTCGCAAGAGTTTGATCATCGCCGTGCACAATAGT
CCTAGAACCGCCCCCAGTAGCATGTAAAGCGGGATCTCCCAGATAGAGAATGGGCTCTCGCCGAAAGACGTGGCCAGAATCGCCGTGGTCGCTTGCTTAG
AGGTGCTTTTCGCCAACACCAGCGTCAATCGAAGCATGACTGCGCCGGAAACAGCACTGACAAATGCCTTGACGTAGTTCGACATGAGGTAGTAGGTCGC
CGTGACTTCCATCGAGAACAGAACACCTCCGATTGGCGACGAAAACAGAGATGACACACCAACGGCGCACGCTGCAGCCAGGAGCTGGATCCGGCCATTG
AGGTGCGAGCTAAAGCCGCAGTAAAGTGGCGATCTCAGGAGGTGGTGCGTCACAATCGACATGATGTGCACGTACGCACCTTCAGTGCCTACCACCAAAC
CAGCACCAACCGAGCAGATGAGGCCCAGGACTTTTACAACGAGGGTGGCAAAGTCGAAGTAGCCAGGGAGATACAACCGCGGGTCGATCCCTGTCAAGAT
TGCCTTCATCTGCGAGACACCAGAGCCTTGACAGAGACAAATGTTAGACACACCCACTCTCGAACGCTCGTACTCGCCCACCACGTGTTACCTGCTGCCA
CAGGTGCAATCCGTGTGATAAGAAGACCCACCAAGGAGAAGACGACAGTGTGACCCGTCCAAATGCAGTATCGAGCTGGTTCCGACGTCGTCTGCCCCAC
CATCGTATCTCTCAAATCCAGCAGCTCCTGACAAACACTAGACCGCAGCAACCCATGAGCCACCCCGCCTGCCCTCCCCTCACCACAGACTCCTGTACGC
ACCTCCTGATCCCGTAGTTCAGGGGCCCCCCAATGACCCCCAAGAGCACCAAAAAGCTCACCGCCTTCAGCTGTCGACGGTAGAATTTCTGCTTGTTCTT
AGCCCGCTCCCGCTCTCCTCCAAACAGCGAGCCGCTGGACATTGAGCGTTGCGCCGCATACTTGCGGAAGGCGTCCAGGAAGTCCGCGTCTTCGCTTCGA
GCGTCCACATCCACTAAATAGTCCCCAATGGACCCATTGTCCTCCAGGTGGTACGACTCGGCGCGCTGCTGAAACTCGTGGAGACTCGCGATTCGCCCCG
TGCGGCGCTTGTGAGCAGGCAGTAGCTGGTCCTCCAGTCCGTTGGCGGCGGACACCATGAGCGTGGAGAACAAATACTACCCCTGAACATGTCCCATGTC
CATCGCTTTGGCCGATGGCCATGGACTCGCTCAGTGGAGGCAAAGGGCGAAATGAACCATCGCCTGCGATCGCAGACGGCAACGACATCGGAGAGAAACG
GTGACCACCTGGCATGGATCGACTGATGAATGGAATTCTAGTTGCATGTACAAGTAGACCGGTACAGTCTGTCGAGTGAAAGCAAACATTTCAGGTCCGA
TTGGACAAAGCGTGAATGATACACGTACGTCGACCTCCTCGAGCAGCTTTCCATTCTATCCATACTTGTACGCGTTACCACAGGTAATCGTCGATGGCGT
GAGTGTCTTCAACCTTGTCGAGCGGATCCCATGATTCCGAAGCACAATGGAGCGTGAGATCTTCAAAGTTTGTGCACTTCAAGCGTCGTCGACACGGTGT
CGGAGTATTAATCACCCTTGAGTTGACCACAGTTAATGGGTCCTACAGCACTTGCAAGAGTCTCGGTATTGGTCCAGGACTGCTGTGCACTGAGGTTCAG
TCGGTCTATTTACAAGTTAGTTAGGGAACCCTCTTGGGTCTTGAACAAAGAGTTCAATGCATGCGTGGAGTCGAGCCCCGTGTCTGGCCTTCGGTGTTTC
TTGACGGACCCCTGCTTCCCAGAAACGAGCTGTCAATGACTGACTCTCGAAACACGACGTCATTTCTCACATATTGATTGACACAACCGTGCTCCTGATG
TGCCAGATCCGCTTCCATTCGCCGTTGCACAGTCGTCCTGAAATCGTTCGTGTAGTTGAAGGGGTGGGGGTTAAGAGGTCCGCTATTTGTGTTTAGCTAA
GAAACTTTAGTCCTGGTATCGCTGGAGGCTTTGATTTATTGATAAACCATTCTGTGGTGTATTGTCGCAGCTAGTTTGCTACAGCTCTTCTTGTATGCGG
ATCCGAAGTGTTGCAGGTACGCTGTCGTGGCGGAGCACCTCTTTCGTATATTTTGCCAATTGGTGCGACTTGAGTAATGCTGCAACTGCTTTTTGTAGTG
TCTTGTTTGTGGTTTTCCAAAAACAGTTGATGCAGTATCCACCACGATCGCTTTGATGCTCTGGTTCGCTCTTGCAGGCCCCTTGGTGGACTTTGGCCCA
ATAAAACCCAAACGCCTCGCTTTCCTGGTGCATCTGCTCGTTTCACGGAGTGAAATAGGACATGCCAATCATGCAATCACCATGAACACAGCATACCTAA
CATTGAGGACGCGAAAACCTACTATTTGGATTGGCGTGTGAGATGTCATTCCCTGAATCGCTGCTTGAGTCTGGAAAACAACAGCCACTTTGCTTTCTGT
GCTCGCTGTCAAATATCTCTCGGTTATGGATTAACCATAGCGTGCACTGAGTGCACGTTGTCCATATGATTCAGATAACTTGCATTGCCGCTTCATTGTC
CTCTCCCCAGTCAGAGCTGTCCGTTCTGGGACGCTCGTGCTCCCGTCCAGTGGCTGACTAACTTACTCCAACTTGCTACTGCGCTCCAACAGTCCAGAAG
ATATGGGCCAAGGTCTCCTTCGTGCCCGCGCGTTCAGGCGTTTTGGAGCAACTGTTGCCTGTCTTACGACCTGGGTGATCAAGGATGAGTTGCGCCGTGG
CGACTCGGCATCTTAAGGTAAACACGTCTCGTGAAGTGCAGCACAGCTGGTTCCTCGGAAGTGCTGCTGTGTATGGCCGACGAACGCGAGAGCCTGTTAG
CTGTAAACCGGACGGTCGTGATTTCACGTCATTGGAGATTGCATGAACTTGGACCGCATCATTGGGTGTAATAGTACAGGTAGAGCGCTTTCATTCCTCA
ATTTACCTCGTCGCTACGGTACCAAGACTCTCCAAAGCGTACACGCACGTACTACGAACTCGACATGAAGATTGTCCAGGCTGTAATCATCGCGGCAGTA
CTCTGCGTGGTCCAGGTTAGCGCTAAAGCTCCCAATGACGACGACCCTGCCCGCGGCCCGTATAACCGCGGGAAAATAGGCGGGTGGTCTGTGTCTCCGG
AAGACTAGAGAGCTCAACGTGCTCTCATGCCACCTGACACGTACACGAAATCAACACGAAGTCGCTGGAAACTTGACGCCACTTTTCATTTCCCTTTCAA
ATACTTTTTGGTGCAAGGTTTTCGTCGCTCACCACATCGACGCGGGGTCAGCCAAACTCGCCAAGCCAAGTAAACACATGCAAACGCCATTCTATCGAGT
ACTTTATGCGGCGCTGGAGAACTTGCCTGAACGTAGCAGTCCTTTCG