Description :
From Genome Similarity Track
Location :
Scaffold_1900:1629- 3662
Transcript NameFunction/comments
Phyta_totarag13839hypothetical protein PHYSODRAFT_301780

Sequence
2033 bases(100 bases per row)
CATACATAGTCTCATCTACGAGCTTTCTTTAATGTGCGTGGTTGCACGTTTTGCACTTCTTGTTCCACACCTGGGTGGTGTGTGCCTGAAACATGGGGCA
ATTGCAGAGCCTGCAAGATCCCATGACCGATgagcggcgctgctgctcctccttgtGATCTTCGATGCCTCGCATCGCGTTATCGATTGCCTCATACagt
ggacgcgctgctgcgggCTGTTCCACGTAACCACTCAGCAACTCACTCGGCTGCAAGTCACGACCATAAAACTTGCGGTTCAGGTCCGAGCGCGCAGCCA
GGATAGCTCCCTGGAGCGAAATGCCAGCAAACAGTCCCTTGCTCTGGGAGTAACTGTAGTTGGCGTTCAGACCGCtcgtgctggctgcagctgcagcctg
cgCTGATCGACCGTACGGACCCACAGCAATATCCAGTCCTGCACCGAGGTTTACCTGCGGCTTGTGGAACACCTTCACAGCTCCTTCCGATCCGAGAATA
ATCATCACCTCCACCAGTTCACCGCCCAGTTCAAATCCACCGCTGAGTCCGAAGGTTCCAATGGCAGATGGAGCCGACCAAGACCCGTCAGGCAACTTCG
CGACAACGAGCCCTGTGCCGATCTTGCCAGATACCAAGAATCCAGCCTTGATAACGGTCATAACTGCAAGACCGTGAGCCTTCTGCAGGAACGCCACCGG
AATTGCGCGGTCAGCGGACGAGCCCCAGTCATTGCGGAAGAAGTTACCAATAATATCGGCAGCGTTGCAGCACTCCTTATTCAGGGAGTTCGTATACGGA
ACGTGAAAACGGCCACGAGCTTCATGGATGTTTTCGGTCTGAGACTGGGCGTACGTGGCAACCAATTCGTCCTGAAGCGGGTGAAGCTGCGGAGCACACT
GGATGCACACCCGCTGTGGAACTGACGCGTCGTAATTCTTAGCGCCTTCAATCTGCTTTCCAGGGGGTACCAGCAGTCGAACGGgggagcacgagctgca
gacaaaAAGTCCACACATACGGCTAGAAAGAGCATCGACAATCAAATAACAACCACATATTCGTCAGCACAGCCCAATCACCCCTAAAAAGCACAATATC
CCTTACCATTGGTGTCGTCGCTTGGTTACGTCGAAGCGCACATTGCACACGTCGCAGTTCGGGTGGTCAGCGTATCGGTTGTTGAGAATGCCCTTACTCT
GCGCGccattgttgctgctcatAGTCGAGTCGCTTCGGAACGAGTCCGCCATGCTCGGGTTCCTATTGGCGAACGCTGACTGTCTCCCATCACTGCTTTc
attgctgcttctactGTTGCCCGAACTGAAAGTCAACGCTCGTTGCTGCGCGTTATaatccaccagctccttccgTCGGTCGTCATCTGGCACCAATCTC
GCCAGCGTCGGGACAAAGTTCCTCGTGCCTTCAGCCCCCAGCTCCGCCACAAGAGACGCATAGAACGGCTGCACGTCCATCTCCTTGAGGCCGAATCTGC
GGCAGTTCTGCTTAAAGTCCTTGACCCCTCGCTCATTGTTGCCCCCTCTCGAGGCTCGAACAGTGCTCACACACCGCTCGTAGTACTGCTGAGCCTCCGC
CCCCGTAGCAGCAGGTGGCACGGGGTCAGAAACCACGGGGGTGGCAGCAGGAGGGGAGTTGATAGAATTGTTGTTGGCATTGGGGCCGAAGCTGTTACTG
CTGCGGAAGGCGCTGGGCACCGACTTGCGGACGTAGGGCTGGGCGTATGCAGGCgggggaggaggaggcggaggtTGAGACTGAGAcccgttgaagctgc
cgtgAGGGTTGTGCTGGTACGTGTTGCCGCCGTAGGGAGAGCTCTCGCTGCGGAAGGCAGAGTCGACGGCTGTGGCGGCTCCTTGATACGCGGCCACGGG
GACGACGGGGACACCGCTGGGATAGGAGGAGGACAGAGAGCCGTCGTCGGCGAGGCGCTTGCCGCACTCGGAGCAGAACTTGCCGCCCGTGTTCTTGGCG
CCGCACTCGGCGCAGAACTTGACCATGACAAAC