Description :
From Genome Similarity Track
Location :
Scaffold_566:16288- 19224
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_566-fgenesh-gene-0.3Pro-apoptotic serine protease nma111

Sequence
2936 bases(100 bases per row)
GAGGCCGGCGACGCCAAGCGCTGGCTCGCGAGCCTCGAGAAGAGCATCCGCGCCATCGTGAGCATCCGCCTGCTCAGCGTGCGCGCGTTCGACGGCAACG
GCGCCAGCTTCAGCGTCGCCACGGGATTCGTCGTGGACCTGGCGCGCGGCATCATCCTCACGAACCGCCACGTCGTCACTCCCGGCCCCGTCGTGGCCGA
CGCCATCTTCCTCAACAAGGAGGAGGTCGACTTGGTGCCCATCTACCGGTGCGTCTCGCAGGTTTGGTAGTCCTCACAGACGCTGGTACGGAGGCTGACT
GTTTTGTGTGTGGCGCCTGCAGCGACCCGGTGCACGACTTTGGCTTCTACCGCTTCGACCCGAGCAAGGTCAAGTTCCTCGAGCTGCACGAGATCCCGCT
GCGTCCCGAGGCGGCCAAAGGTGGGTGAGTGTGTTGCCGCTGCTGTATTGTGTGGACATGAAACTCACTCGGGGGACTCTCGACTGCTGCAGTCGGCGTT
GAGATCCGCGTGGTCGGCAACGACGCGGGCGAGAAGCTGTCCATTCTGCCTGGCATCCTGGCCAAGCTGGACCGGGACGCGCCGTCGTACGGCTCGTCTA
CGTACAACGACTTCAACACGTTCTACTACGCTGCGGCGAGCAGCACATCTGGCGGTTCGAGCGGCTCGCCAGTGCTCAACATTGACGGCTGCGCCATCGC
ACTGAACGCTGGAGGCGCCAAGAAGGCTGCGTCGTCATTCTACCTGCCGCTGGACCGCGTGGTGAGAGCGCTCGAGTCTATTCAGCGCGGGCAACCCGTG
GCGCGTGGCACGCTTCAAACTATCTTCAAACACACGGCGTTCGACGAAGTGCGGCGTCTCGGACTCCCAGCTGCGACTGAGGGAGTGATTCGCCAACAGT
TCCCGATCGAGACGGGCATGCTTGTAGTCGATCAGGTGGTGCTTGGCGGCCCCGCGGATCAGAAGCTTCAGACTGGTGATGTGCTGATCAAGTTCAACGG
TCGGTACGAGACCACGTTCCTGGGAGTCGAAGACTTTTTGGACTCGAACGTTGGCAAGTCGGTTGAGATCGAATTCCAGCGCGGAAACACAACGCACGTC
GTGTCGCTGACCGTCCACGACCTGCACGCCATCACTCCAAACCGGTACCTCGAGGTCGGCGGCGGCATCGTTCACTCGCTATCGTATCAGCAGGCGCGCA
ATGCGTCACTCCCAGTCGGCGGTGTGTATCTGGCGCAAGCGGGACACATGTTTATGAAAGCGCATCTGGTGCAGCCGTGCATCATCACAGCAGTGGACGG
GAAGCCAACGCCGACACTGGACGACTTTGTGCGCGTCGTGTCGGCGTTGCCCAACGGATATCGATCGGTGCTGCGCTATTTTATGATTCGCGACCGCCAC
CGCGTGCGGACCGCGTTTATCATGATGGATCGCCTGTGGTTCCCAGTCCAGATGTGTACAAGGAACGACGAAGACGGGCTTTGGTATGCAGTTCCGTGCC
ATGATGCCTCGGCGCAGCTGGAGTCGGTGAAGCCTACGAACCCCACTTACGCTCCTGCGCCACTGAGTTTCCCCGGAGGTAGTGCGCTCGGGAAGAAGAT
GCTGCTCTCGCTTGTCATGGTCTCGTTCGACATCCCGTACATGGTGGACGGCATTTCCAGCTCGAGTTACCACGGAATGGGTCTGGTGATTGATGCCGAG
AAAGGATTTGTGCTCGTCGACCAGAACACGGTGCCGATCGCTCTCGGCGACGTGCTGGTGACGGTGGCCGCGTCCATCGAAGTCCCCGCGAGAGTCGTGT
TCGTACATCCGGTGCACAATTTCTCCATCGTTCAGTACGATCCGAAGGAGCTCGGAGTGGTGGCTGCGCATATTGAAAGTGCTGTTCTGGCGGAGAAGCC
GCTTCTTGTTGGCGACTCGACTGACTACATTGGTCTGAGCAGCAACTGGACCGTCGTGACGATGAAGTCGGTGGTGACAAAGACCGACCGGTTGGTGCTG
CGCGACTTCCAGCCTCCACGGTATAAGGCGTCGAACGTGGAAGTGCTGCACTTTGACCGGATCACCAAGTCGGTTGGAGGCGTTTTTATGGATGAACTCG
GTCACGTCAGTGCTCTGTGGCTGTCGTTCAGCTATCAAGATGCGACTGGGCGGAAGGAAGTGTTTCGCGGTCTCCCAGTGAGCATCATCCGCCCAATTGT
TGATCAACTCCGGCGGGGAGGTGGACACGTCCCCGACACGGTGACTATTCTTCCGGCGCAGCTGCTGACGTACTCGCTGTCGAAAGCGCGATCCGGTTTG
GGACTTTCGGACGAATGGATCCAGCGGTTGGAGAGTTGCTACGAAGACAAGCGGCAGGTTCTTGGTATAAAGCGGTGTGCTGCGGGGACGGACTGCGCAG
ACAAGTTGGAGAGCGGCGACCTGGTGTTGGCTGTGGACGGCCAGGTTGTTGTTCGAGATGCCGACGTGGAGCTTGCGACGAGTGACAAGCCTTCTGTTCA
GATCCTTCTCATTCGTGACCAGAAGCAGCTTGAGGTTTCAGTAAACACTTCCCAGCTCTCGGCAATGGGGACGGATCGCGTGATTGTGTGGTGCGGTTTG
GTGATTCAGAGCCCTCACTACGCGGTGGCAAGTTTGGGGTACATTCCTGAAGAAGGTGGCGGCGTCTACTGCTCGCGGTGGTGCTACGGCTCGCCAGCGC
ACAAGTACGGGCTGCGAGCGACGATTTGGATCGTGGAGGTCAACGGCGAGCCGACCGGAACCCTTGACGAGTTCCTCCACGTCGTGGAGAAGCTGGGAAA
CCGAGACTCGGTGCGGCTAAAGACGATCTCGATCAACACGAAGCCGAAGGTGTTCACGCTCAAGACAGACTTCCACTACTGGCCAACTGTCGAGCTGCGC
CGAGAAGGATTGGACTGGAAGTATGTGTCTCATTCC