Description :
From Genome Similarity Track
Location :
Scaffold_14:162878- 164171
Transcript NameFunction/comments
g1182.t1KUF86418.1 hypothetical protein AM587_10009880 [Phytophthora nicotianae

Sequence
1293 bases(100 bases per row)
CGCACTGGCACCCGCTCCGTGTATCTGCCGCAGCACATTGTGGTGCTGGTCCACGGCAACAACGGCTCGGCCGCAGACTTTGACGCCATGGAGGGCGCGC
TGCTGGCCAAGTTCGGTGAGCGGCAGATGCTCATCATCAAGTCCCACGCCAACGAGCCGGACACGTCACTGGGCGTGGAGATCGGAGGCACTAGACTCGC
CAAGGAGGTCGTAGAGGCCGTGTTCGAGTACGACCTCAGCCCGGTCGTGAGCACCTACAAGCTCTCGGTCATCGGCCACTCGCTGGGCGGACTGTACGCG
AGATACGCGCTCGTCCAGATCATGGACGCGCTAAGCTGCCTGCGCGTGGAGTACGTCGATTTCGTCACGATTTGCACGCCGCACCTCGGCTCGAGGCGCG
CGAGAGGACCGTCAACCGTGAAGGTTGGTTGTGCTGGCCGTGGCGTCGTGGGGATTGCACTATCGGCTAACTGGGGACTCTCTTGTGTTGGATGCACAGA
ATATCCTTCGCCTGGGAGTGCATAAAGTGCTTGCGTCGCGGTCGATATACGGACTGACGGGCATTGATCTTTTGTTAGATGGTGAGCTGTCTTGTCGTGG
GTAGAGGAAGTCGTCGATTGAGGCTGATGTGTGCAATGTGAATGCAGCACAAGAACAGCAAGTAGGACTCACAGATGCCGATGCTGTGGCGTCACCTCGT
CCACTGCTGCAAGTGATGAGCGACACCGAGTCGGAGTTTATCCGCTCTTTGAAGCGCTTTCGCCATGGCACATTAGTCGCAATGACGGACGGCGATGTGG
TGGTGCCGTACCCCTCAGCATCCATGCGTAGCTACAGCCCATACGTAAGCACCTTTCTCACAGAGCGCTACATGGATTGGCGGTGGCATGTCCGCCACTC
TGGCTTTGGCGAGAACGATGACAGCGGCCGTACCAACCCTGCATATGCGGCATTCTTGGGGCGACTGAACTCGAAGATCGACTCTTCCATCGAAGTTAAG
GAGCAAGAACTTGGGCTTGATGCTACGTGTGCTCCGCGATATCCAAGTATTGAAGGATTCGACTGTGACAATAAGCAGGAGGTGGAGTTTCCGCATGATA
TGCTCTGCCGTCTGCAGCACGCGCTTCCGTGGCGACGCATTGACGTGACCGTGGAGCCCTGCGGCATGAAAGGAAAAATGCGTCTGCATGACTGGCCAAT
CAGCAAGATGCAACCTCCCGATTGCCGCGCGGACGAGTTCATCGATCTTCTGTGCGATATGATCGGAGCAGACCACCAGATGCGTCCATTGCC