Description :
From Genome Similarity Track
Location :
contig_30:162815- 167612
Transcript NameFunction/comments
g5298.t1hypothetical protein
g5299.t1hypothetical protein PHYSODRAFT_532657

Sequence
4797 bases(100 bases per row)
AGGCAAATCGTTCCTGACCCGGCGAAGTTTCCTCGCTGTAGCCTTGCAAGTACTACACAGTGTACTACACATGCATCTCACTCGGACCAATCGTATGCAT
GTCGGCCTCGGTGCCAGCGAGTCGATGCACGTGCAGTGTTGGCGATGTCAATTCTTGTCAACAGCGGAGCTCGTTGTTGTGGGTACTGGATCCTGGAGAC
CGGCTGGATATTCTGCTGATGGCACCACTCCATCTGGCTGCAGGTGATCTTATCGCTTCAAGCTCGAAGAGCGTTTACGGCAGAAAGAAGGCCCCATGGG
TAGGGGCGATAAATTACTTTGTTATAATACTCGGAGCCCACCGGCTTAGTGTCCGTAATCACCAACCTGCAGGAGCTCTTGTCTATTTCTATGGGGGCCT
GCTGTCCTTCACATGACCCGCTGTCGTTTGAGGGGGGCTGGACCGCACGGGATCGAGGTCATAGTGCGGCGCTCGGCCTCGACGGACTGGTACTTGGTCC
ACAGGCGGGTGAGCATAGCCTCCTCCTGCTTCCGGCGGATGTAGCTGCTGGACGGCGGCAGGTTGGCAACCGCGAGGCGTTTGGGGGTGGCCGGCGTGGT
CTCGGCGAACAGGCTCGGGTCCAGCTCGTTTAGGTACTCGTCGAGTCCTCGGATGAGCATACGCTCGGCGGGGCGGCCCTCGGTCGGTTTCTGTTGCTGC
TCGAGCTGTTGTTTGCGCTCGAGGAACTCCTGGATCTCCTCGTAGTAGCTGCGCGAGCGACTGTCGTGCACACCGAGCAGCAGACTCGCGTCCTCGTCGA
GCCCGCCGACCTGCGCACTGATATACTGCTGCACGTGGTCCATCTCGGCGCGGTACTGCTGCTCTTTGGCGGGCGACGCGAACTGCAGCGGGCGACGCAC
GATGCGGTGCACCGGCTTGGGCGGTGAGCAAATAGCGCTGCTGCTGCTGCTTGACATAGGCTTTTCGTGGCTGGTGGTCTGCAAATAGCGGAATGGACCT
TGACTGCGGTGGAGCTGCTCGGCACAGAAGTCTCACGGGTGTTACTATCGCTTCAAGGAATGGGATCGCCCATCACTCCGAGCCAAAGACGACGCGACAA
CATTAGGTACCAATCAGGTGTGGTGGATTCTTTTTTGGTTACCTACACCTGCAATATAAGGGTTTTCGGAAAGCTGAAGTGTATTGAACTGCCTAATCCG
TTTCACTCGAGTTCAGCAGGGTCATAGGAAGGTAGAGTAGAAGACACTCACTCCTGCGCTGCGTCATCTGGTTCTAAAAAATCGGGAAAAATAGTCGAAA
TTTGGTCGCCGACATACAAACACCAAATACACCCCCTTTCGAGTAAAACGACCGCGACATTCATCAGCAAAGCCCGCCGAGCTGGATTGGCGCGCAGGAT
ACTTTTGCTATGTTGGTGGTGATCCTGGTCGCCTCCGTTGTCGTCGAGCGTGGGTTCACTCTCTTTACCTGGTTCACTCCTTGAGCAGCGCGAACAGATC
GGATCGGGCGAGGTGCCAGCAGCGCGAGCAGATGGTTGCACCGGTTGACAGTCCCAGAACAGCGGCTTGAATCTTCGGTTGATTTCATGTTTTCAGCGAT
GGGACCCGCCGTTCCTTTCAGTGGCAGCTCCAGGCGCTCGTGGCAGATCACAGAGCAAAGTCACATACATGTACAAACCGTAGTTGAAGCGCTGCGTCAT
CGCAAAATGCCCTTGATTCCCACCGCTCGACATGTATTGGTCAAAACGCTCATCAGTAGCTATTTCGGCCAATCCGACACCACTAGATAGGAGAGCGGCC
CATCAGGTTCATCACCTGCAGTAGCATGGTAATGCCGACGCTGGGCAGCGGAGCCGCAGAGCGCGCGCTGCTGGCCGGCGGCTTCCTGCTGCTCTCGTCT
ACCGTGGCGCTGTTCTGCCTCGAGCGCAAGCGCCTCCGCCAGCGCGCGTGGCGCCAACGCCTCACATACAAGAAGCTGTCGAAATCGTGCGGATTTTCCC
TTCCACTTGTCGTTCCTTGTCCGCCTCTAACCGCGTCTGAGTTACCTGCAGATCCGACCTGGGCGCGTCCTTCGGCTTGGACATTGGTGTGAAAATCCAC
TGCAGGAGCTGATTTGGCGCTGGACTGACGCTGTTTCCTTGGCGCAGGGGGAACACTGGCCAAGATCGTGTACTTCGAGCGCCACGAGGCCGGCAACGAC
AAGCGCAAGAGACCGCGCTCGGCGTCGCTGGATGTGGCTGCGGGGGAGATGACTCAGTTCCTGCGCGAGAACGAGTCGTTCGGACTCACGGGCGTGCAGG
ACGTGCGGCTGCGGATCCACTCCAAGACGCTCAACGGGGTGCGTTGTTGCTCTGTGGCTGCAGTTCGTGGAGAGTTTAGAGACTTATTGGCTGGTTGCAG
ATGTTCCACTTCGTGCAGTTCGAGAGCAACAAGACGCGGGAGGCGATTGAGTTCATTACCAGCAATGGGATCAACCAGTCCCTGCGGATTCTGCCATGTA
CGGGCGGTGGTGCTCACAAGGTCCGGCTTTGGATTTTTACCGTGGAAATTGGAGCTCACTGCTGACATCTCGTGTTCTGATGGTGGGACTCGTACAGTAT
GGCCCTGCTTTCAATGAAATTGCGGGAATCGAGCTGGAAAAATATGACGAGATCGAGTGCACGATTCTGGGCCTGCATCTGCTGCTCACGACACTTTCCG
ATGAAGTGTACACATTTGAGGTATGTACTACTCGGCTAGTTTGTAGCAAAACAAGACTAACGCGATCGTTCTGTTGCTGAGTAGGTCGTGGATTTTAATT
CCTTGACGGCGTCACGGGTGAAAACCATCCAGACGGATGTGAACGAAGATGTGTACCCCTATCTGGTGCGGCTAATGTTCACAGTTACCACCCAAACCAA
AAAAGCTAACTCGAATTGTGTTTTTGCTCACCGCCACAGCTTGTCAGTATCGGCTCGGGTGTGAGTGTGTTGTACGTGAAGGGGCCGGGTGATTATGAAC
GTGTCAGTGGCAGCAGTATTGGTGGGGGCACATATTGGGGTCTTTGTCGGTTGATGACTCACTGCGAGTCGTACGACGAAGCGTTGGACTTGTGTGTCCA
TGGCTCCAACAAATCGGTTGATATGAGCGTGGGGGATATCTATGGTGGGGCATACGGCAAGTTCAAACTACCAGCATCCACAGTCGCCAGCAGCTTCGGG
AAAATGATCTCGGTTTCTCGCGAAAGCGTGAGCGATGCTGATCTTGCTCGCTCACTGCTGGTTATGATCACGCAAAACATTGGCCAGGTTGCCTTTCTGA
ACGCGACATTGTACAAGACCAAGAACATTTTCTTCGTTGGAAACTTTCTTCGCCACAACAAGATTTCATCGCGGACGCTAGCGTACGCAATCAACTTCTG
GTCTAATGGAGCAATGGAGGCACGGTTTTGCAAACATGAAGGTTATCTCGGGGCGCTGGGGGCGTTCCTTCGCCACGCAGAGGTAACAAATGCCCATGGC
GAAGAGTTTGTTTCGGCAACACGAGGATCAAGGCAGTTGTAGTCCTGCTTGCGCGATTGAGGAGCGCCTCTGCAGCTCGATCGATGCATATCAAGCGAGG
GTTCAATTCAAATAGAATTGACGACGTAGACTTGCCGTTGAGTGCCACGGTAGTCTGCCGAGTTTTGTGGGCAAATACTGTGCTAAGCTTACTATCTGTT
AGGTACTACGGGTTATTCAAGACTGCACGTACCAAGACTGGTCTGGTGCGTAAGTAGGAGGACAGGCATGGCAAGTGGATGACGAAAAGCTCAGATATGA
TGGTCTCGTGCGCTTCGTTCACATGGTTAGAGAGGTTCCACCAAACGAAAACAGATCCTTTCATGCAAGAGCTACGCTCTTCATCACTAGCGTCGCGCTT
TAGCGCACCGATCCAAGTGATCAACGCCCTGAAAAACAGCACACAAGCGCCTGCACGCCTTGGTGGGTCATTCGCGTCTCGGTTCCGTGCAGCGACTAGC
CTGTCAAAACCACTGGTGACGCCACCGCTACCGAGCAAACTCGAGATGATGAGTGCCCGGCAAAGAGGTCTGCTGGGATTATGGGCCTCATCTTGGTGGA
TTGCGCGTTGGCGATTATCGCTGAGTTCACGAAACGCATAGACATGACCTGGTGGTCGATCCTCCAAGCACTCGTGACGCAGCAACCTCTCCTTTGATGG
GGTGAGTGAGTGAGATGGCAGGTGGCCGTTGTGGATCAAATGCGCCGACATCAAGACGATCGAGCCCAGCACTGGTAGTTTCATTCTGCAAGTTTCTGCC
AAGTGACCAAGCACCAACCCAGCCCAATCCACCATGCCGCTCACCGTCCCTGGCTTCCACACCAACACGCCGCTGGACGCGACGTTCGACAAGGACATTC
GTGATCTGCACCTGATCTACGACTACGACGCCGAGTCGGAGGATGGCAAGCCGGAGAAGTGGCGCTACGAGCTGTGGTTCTTCTCGCACGACCGCGTGGT
GTACGCGATCCACGGCGGTCCGATGGCCGGCCGCACCAACTACCAGACGTGCTCGTACCAGTGCGTCCGCCCGGGCGAGTTGTGGCAGTGCAACTGGCTG
GAGGAGACGGGCACGATCGTGAGCCTGGTGTTCGACATCAAGCTGCAGAAGTTGACGACCATGATCGGTTTCTCGAAGGGCCACTGGGAGCACCCCGTGG
AGGCCCACGGCGACAAGCGCAACGCAGAGGACTTCGCTCGCTGGCGCAAGCTGGCGGACTACGGCAACCAGAAGGACCGCCTGCTGCTGTGCGAGCA