Description :
From Genome Similarity Track
Location :
Scaffold_1245:1628- 7602
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1245-snap-gene-0.3Nipped-B
Pytul_var.sporangiiferummaker-pug3_contig_1245-fgenesh-gene-0.2GI24174

Sequence
5974 bases(100 bases per row)
CTCGTCGTCAATGACTGAACTGTTTTTGTTGGAGCACAGCTCGTTTGCCACATCACTTCAACAAAGTGCAGTTGCGGTCTTGCGCGGTATATTCCTTCAG
TACGAGGCGCATCGTCCGTTGATGCTGGATGAAGTTGTTGCAATTATGGTGAAATTACCAACATCAAAGCGCACTTTGCGAAATGTCAAGTTATTGGACT
CCAATCACAGCATTCAGATGATCTCCACACTCGTGGTTGCGTTGATACAGTCAAGTGCGTCAATCGATGAAGTTAAAAACGAAGGTGCTGAAAGCCACGC
TGCGCAAGATCCGACTCTCATGTCTTCGAATAACCTGGATGAAGGACCTGAGTCAGAGAAGAAGAAATTTGCGAGATGCCTGGAAGAGACACGGCAGAAC
ACTCGGTTGTTCACTGCTTCGCTGGTGAAAGAGTGCTTCAAAAAACACGACGAGCGTAATCACAGAGTGGTTTTGGAGAATTTTGTGGAAGATCTTCTTG
TGATGTTCGTTCGACCAGAGTGGGCGGGTGCAGAGGTGCTCTTGGAGACAGTGAGCTCGTCGCTTGCAAGCATCTTGCATGCTAACATGACAAAAGATTT
TAAAAAATTGGAATCGCAACACACTGTGACGGCGCTCAATCTGATCGGAAAGATCTGCACGTCGATCAAAACGTGCCAAAATGTTGCAGCGCGTGAAATA
CTGGAAGACGATATGGATGCCCGGTCAGTCCTAGCAGAGCACGCACGACATCTGAACAAGGTTATTCCTGAAGCGAAGTTCGACAGCGATGAAGATCTCT
TGCGCTTGGATGATAACAATAAAATGCTACTGAAGCATGCTGTGATGGCTTTCATGAGACGAAGCAATCGCTTAAACATCGCGCAAGCTGACTCGAGGCG
ATTGCTTTTGGCAAGATTTATATTCGAGTCTTGCGCGAGTTATGATGCCAAGCGCGGCGATATCACGGAGGAGTCGTCGCTTTGGAAGACAGAGTTGTCC
CTTTGGAAGACATTTTGGGATACTAATCCTGGAAGCGTGTCAAAAATAGCACCGCCAAGTGGTAGTCTTGGCCTGAAGTTGAGCCTACACCTGGCTACTA
CTCGCGAGTTTTGTTGTCTGTTCGACAAGTTGCTCGCCCATGTCATGTCACTTTTGTCGAAGGGGATACCAACATTCCGAGCCAGAGTTTTGAAGGTGCT
GGCGGGGATTGTTGACGTAGATCCGATGCTGATGGCTGAGCGTGGTGTTCGTGAGGCAGTTCAGCGATGCTTTTTAGACGAAAGTACCTCGGTTCGTCAG
GCAGCAGTAGACCTGGTGGGAAGATACGTAACGCTCCAACCTCTTCTGGTACGTATTGTTGTTCTTGTCTAGCAGGTGAACTCTTACATGCTAATTCCTT
TCCTTTTTTGTGCAGTTTGATAGATACTTCGATATTCTAGCAGAGCGCCTACGAGATAAAGGCATCAGCGTTCGGAAGAGTGTGTGCAAGACTTTTCGAG
CGTTTCTCATATCGGTGTCTCATGTCAAGGATGAAGTGGACTCCATTTCGGAAGAAGAGCTGAGGCGCAAGAGTGCATGCATGCGAAGCTTGGTCGAGCG
CATCGGGGATCCGTCAGAAGAAACTCTTGTCAAAAATTTCATTATTGACACGTTCCAGGAGGTTTGGTTCGGATCGGAGCTCTCAGCGAGACAACTTTCA
AGTGATTTTGTGGACGAGCTCCCAACTGAAGAGCTACCCCCAGGATGGAAATCGGTGGAGAGCACTTCAATGAACAACGATCCTGCGCCGCAATCTAGCA
CCAAAAGAGTCATGATTCTTGAATTTCTTTCTCCCGATGGTAAAGTTTTTTCCTCACGTGATCAAGCATGGTCAGCGTATCGTACACCACAAGTCACTCC
GTCAAGCATTGTCGAGAGCAAGCGTTCGAAGCAAGATGACGTTCGCCAAATAGCAATCACAATAGTTGAGGTGATCCACGACATGCCCAACCTGGATTGG
TTTGTTGCCCTTCTGAGACGGTTGCTGCATGAAGACGACCAAGAAAAATTGTCGAAAAGTGGTACACGGTTCAACAGAGATAGGTCAGACGAGGTCAAGG
TTGCTCAAGCGCGCTCCGAGAAAATTGTGGAATGCCTTACGAGCTGTCTTTGGCAGCTTGAAGAAGGCGAGCCGCTTAAAGGGGTTACTATTGGAGACAT
CCAAATACAGTTCGTGTCGTGCATGGAGACGCTATCGGCGTTTTGCGAAGCCCAGCCAATGCTACTTCATCAGTACTTGGAACTGATTATGGTGCACCTG
GTTGGTGATGAGAAGCTGGAGAAGGGAGTTGAGAACAAAGTGCAAAGCCTTGTTTTGTCCATGGTAAACAATGTCTTCTCGCAAATGGAGCGAATTCCTC
CGCGGCTTGTCAAACGACTAGAGGATGACTTGAGGACCTTGGTGTTTCGAGCACCGCCAAGCGTGGTTGGCCCAAGCATTAAATGTCTCGCGACGATATC
TACTAGCACAAGGAAACCCCCTGTTCTACTGATGAAGCTCTTGGAAGTATTTTACTCCTATTTGCTGAAGTACAAAGATCTTGACTCCTTGGCAAACATT
GGACCAGACGCCAGCTCATCTTTACAGCGAGCATTGTTTACTGCTGGACAGGTCGGAGGCACCCTTGATTTGGACACCTACGACCTTCAGATCAGTGAGG
CAATAAAACTCAAGAAAGGAGCAGTAATGGAATCGCTCTATGAAACATTTGCACGGTTTCTGCGGATGGGAGGAGACACAGCATGTTCGGCGAAGGCTGT
CCAAGGACTAGGCTTTTTATTTCTCACGCGTCCGCGACTTCTTCTTCAAGCACAGCAAGACAGCATTTTGGAGTTCTTGCTCGCAGAATCTCCAGATGAA
ATGAAACTACAATGCTTGACGAGCTTGAGAGAGTTGCTGAAGTATGAAGAGCAGCGGTTGGAGCATGGAGTAGCCACGAAGAAAATGAACACAACGAAAA
GCAAAAATGAACAAGTGCAAGGAGATCAAGAGGCTGATGCTGCTCTCATTGGGAGTGTCATGCAGGCGCAGCTGCAAAATATCCTGGTGCTGGCATTACA
AAAACCAGTTAGGATCCGTACTGAGGCTGTCACATGCATCAGTACCCTGTTAACACAAGGACTGGTGAGTCCAGTGCATTGCATCCCGAACCTGGTGGCG
TTGGAGACGGACCAAGTCGTTTCGATTCGTGATTTGGCACATAGCCAGTTGGTGGCATTGCACGAGAAGTTTCCGATGCTGCTGAATACCCCTTCGATTC
AAGGTATCTTTTTATCGCACTCCTTCCAGCTGAATGCGTTCGGAACCAGCTCAGTGTACACAAAAGACAAGTACAAGCACGACTATTGTCTTTTTGGAAG
GCTCTACTCGAATTGCATTCGCACGGCAAAAGTCCAGCGCAGCATGTTCCTGAAAGCGCTGGTGAACCAGTTCTCTGACTCAGGAAGCATGCTTGGAAAT
ACGAATGCGAAACCAAGCTCACTTGTGCCCATGGGAAGCACCTTGCCATATTTATGCTACCTGGCGCAACTGATCTCGGCTTTGCCGTACGATTTAGAGG
ATGAGCCTCTCTACATTATTTATTTGATCAACCGTGTCGTCACACTCAAGCTCGGGTACGTTACCGTTGACTACATGTACTTAATACCTGATGGCAGCAT
GTATCTAACGCAATTGCTCTATGTACGTAATGTGTAGACCGACGCTCGATAACATCAAAGAGCTCTTTGCACACGCGGGGGCTCCTTCTGATATTATGAA
AGACGAAGACACAGACTTTTCGGACGTCGACATCGCGGATTATCTTCCTACCATGCAACCAACAAAAGACGACGCTGGACGTCTTCAGACGGAGTGCTGT
GCCGCATTCGCGGTCAGTTTATTGATTCGCGTAAAATTTCATCTGAAGAATATGTACCAGCTCGAAAACGAGAAGTGCATGACGTACCAACCAGGAAATT
CGTCAAAGGTGAGTGCAATCATGATCTCCATTACATCTTCACGATTTGGTCTATTTTACGGCTCACTGATGCACCACTTCTTTATCGAACGCTGCGTTTG
GCAGGCAACGGAGCAACCCACGATGCAGTCCGGACGGACATCAAAACTGAAAGTGCCTTCTCTCCCTGAAGCTGCAGACCCAATTGAGTGGAGCTGGCAC
GTTTTTGTGCACGCGTGGGAAGCTGCGCGCGACGACCAGCACCGAATGGACTTTGAAGCTCAAGAAGATGTTGCAATGATGAACAGCAGCGGCAAGACTA
GGAGAAGAAAGGGCAGCCGCCGGCGCAAATCGATGCAGCCCAAGCATGTCGAGAGCACTGACGACGACGATGTAGAGTTTGTGGAAGGGCTTGCTGAGTG
ATATGAGTTAATTTTCTCACTGCGTGGCATGCGTAATATATGATTCGTTGGATTTCTTCAGCGCGTCCAAAGTGCGGAGAAACAGCACTTCACACTCCGA
AACACTGACTCCATGGTACGATTGCAGCGGCACTACTGGTCGTAACTGGGAGAGACCGTCATGGAAGACATCGACAAGCTTCACAAAGCACCAAAAGCGC
TCCATCTCACTGCCGAACACGTCACACACCATCCGAGCGACCGCATCCAGGAACTCTTCGTCTTGCATCCCATTCAGCAGCTCTTGATGCGCCAGAATCT
CACACCAGTACGTCCGGTGCAATCGGATCAAGTGGCGGCGCTCTAACATGCTACTCGTCTTGGTCCCAAGCTCCGCTTCGTTCTCCGTCCCGCCATTGCC
ACCAGCATCGTCGCCTTCTCGCCAGGTGCAACTTGGAGACTCTGACTGCATGTTCGTCGGATTCACTAACAACTGACGATCTTCACTTCTTGCACTGGGA
CAAAGAACCTGCGCTGCGTCCACTATGTCCTGGAACATCTCTTGCTGCTGCTCGAGCGCGAACTCCCAAAGCGATGGATACGGCGGTAATACACCGGCGA
GTAGTTGCCACACGATCGCGCGGTACTGAGGCGGCACGCCAATCTCTTGGACAAGCTTCATGACCTTGGAGCGGCTCACCACGGGCTCACCAAACAGCGC
CGCGTACATGGCGATGCGCTGCATGACAGGCACGCCCAGTGTCTTGTAGTACGTCGTGCGGAAGTTGCGATTCAGTGCCATTTTCGCTTTTCGTCTTGGT
GTTTGGTGCCCAAAATGGTCTCAAAATGGAAAGCGCTTTACATATAACTATTGATTTTAAGGGTACTCACAGTAAGCGTTATTGTGTTAACTATACCCAA
AATGCGGGTCACTTCGGGAACGTAATTATGGTTTGTCATAATCAGGATTTGCACCATGGCAGTCCGCACTTAATCATGTCGAAAGCGTTCCTAACACCGA
ACTTAATGGAATCACAACGATCACAAAAGTCGAGCAAAGAATTCCACACCACACTAGACAAGAAAAAGGGCTCTCCTTCCAAACGACCCTTCCATCAAGG
GGCTAACCACTCTTTCGTGATTATCTACGCGATACTGTCACGAACAGTTCAATTATATTGAGTTACCCATTTTGATCGTGACAGATGATGCAGCAAACGA
TGGGTCCCATCACACTTATCAATTGGAAAAGGAGACTGTTTCAGCACTCAGCAATACGAACGTGTCATCGTGACGAAAACCAATTGGCGCGCAAATCGCT
GCGTTGGAACTGATGCACACACATCCACCTCATGCATGTGAGGTGATAGTCAAGTACACGCACTGAACTTCTACTTCTGGTGATTAGCGTACAGCCAATT
CCGACCCTAAGTGCGCCTGACCTCGTCTTGCAGTTGGTTGATGGGTACGATAGGTGGACGTCAACCATGCGGTAGGATTTCCTTGCAACGGAGGAAAAAT
CTCACACCTGCTCATCGGATCCCTTGACCGAGTTGCACTCTGCAATGGAGGACAGCGTTAGAAGATGCAGGCAA