Description :
From Genome Similarity Track
Location :
Scaffold_8:16274- 20405
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_8-snap-gene-0.32Calcineurin-like phosphoesterase
Pytul_var.sporangiiferummaker-pug3_contig_8-snap-gene-0.33Calcineurin-like phosphoesterase

Sequence
4131 bases(100 bases per row)
GCGATCTCTCATATGCGAGAGGTGCAACGTACCTCTGGGACCAGTTTGGGGTCATGATTGAGGGTGTGGCGTCCCAGATCGCGTACATGATCAGCATCGG
CAATCACGGTTTGTATTCGTGCAGGTTCTTGATATTAGGACTGACTCGCCAGCTCACTTAGTTGTTATCTCTGCATGTGTATAGATTACGGATACAAGGA
AGGCAGAGGCCGTGATGACAAGCGCTTCCCGTATCATCCTATATTTGAAAAGAATGACGCCGCAGGTTTTGACGCCAAGGGCGAGTGCGGCGTGCCGACG
TTGGCTCGCTTTACGATGCCCGACAACAAGGAAGGCGGCAGCAACGCGCCGTTCTGGTACAGCACCGAGTTTGGTCTCACGCATCACGCCGTGATCAGTG
CCGAGCATGATNNNNNNNNNNNNNNNNNNNNNNTCCGCGCGAGTTCGCCGATGTACACGTGGCTGATCGACGATCTGAGCCGCGTGAACCGTACAAAGAC
CCCGTGGCTGTTTCTGCACGTACACCGTCCATTTTACTGCTCGGAGACCTACGAACGCGACTACCGGCGCTCGTTGTTGCTGCGCAACCAAATGGAGCAT
CTGCTGGGACTGTTCCGCGTCGACATCGTGTTTTCTGGGCACTACCATTCCTACGAGCGAACGTGCCCTGTGTTTGACGAGGCATGCTATTACGGAAACG
CTACTTCGACGCGCGACGACAAGAGTTTTGGCGCCATCTCGTCTGCGAGTGCGCCCGTGCACATCATGGTGGGCTCAGGCGGCGCAAGCGTCGATGACGA
AAGCTACTACAGCGTCGACTGGAGTCGGAAAGTGCTCCAAGACTATGGCTATGGCCGCGTGCATGTGTACAACGCGAGCCATTTGCACTTTGAGTTTGTA
TCCGATACGAGCGAAGCAGTGAAGGACTCTGTCTGGATCGTCTCGAACCACAACTGGCCCAACAGTCGCGTGCGGCAAAATCGCACCATGCTGGCACGTG
AATGGCGGATAACTTTGATCGTTATGGGTGTGCTGGTGCTTGGGTTGATTCTGGTATTTATTGCGAGCCGAGTACGTCGCTCATGGAAGCTAGCAGGTGC
GTCCTTGCTGCCAAACAAGCACAAAGCAAAGAAATCGCCTTCAAAAGACGGCATGCGGCACGCAAAGTACGTGCGCAATTCAGCTGGTAGCGACGAAATC
AACCTTGAGAGTCAAGCATTTCTAAGTAGCAGTCGATCGATGATCCAAGAGCACTAATGAACTTGTACGGAATGCAAATGATGGTTCGTCACGGGCTCTC
TCCTTTTCCTTGTGCGATGTGGCAACGTTGACTGGGCACGTGAACGTCCAATGTCACTAGACTATGTCGTATCCACCAACAAGCGACCCTCAGCCGGTGC
ATCGCCAGTAGCTGCGTCCTCAAAATACCCGAGTGGCTTTTGATCGGAATCGCTTCCAAAGGGTCACAAAGGCGTAATTTGCATGGAGGGATGGGTGCCA
GTGGCAAATGCCGACGCGAGTGCAGTCCCACCATTGTCGTCGCACGATGAGGCAAAAGCAACGAGCGAGCGAGCGATGTCTCATGATGTGGCAGTGGCAG
CAACAGAGGACGCGTCAAAAGGAAGCGCACGATCACCCGCGAGTGTTCTACACGAAGACCAGGATGTAAAGCAGCACCAGTTGCTATTTGGGCATCTCTG
CGTCGTGTTTGAGGCCAAGGCCGATGTGCTCCACTCTCGTAGCAAACCGTGCACGTCAACAAATGTGTCGCCAAGCGCGCGTACACGGAGGCTTTACGCC
AAAGTCTCTGTGGACCCAGGCAACCAGTACGGTGTCAGTAAAGCGTTTGTGATCGAACGTGATATCATGACCTGGAGGGACGAGATTCGGCTTTCTACGC
CGTCACCTGCTGCCTGCATGCTGCCTTTCGAAGTGGAGCTGCTCGTGGAAATTTATGAGATCCACAGCGAAGTAGAGCACGAATTGCTTGGGAGTGGCCG
CATAAGCGCACGCAGCGTGATGCAAAAAGAAGGAAAGGACATGGACGCAGCAGCGATCAGACTATCACGACGACTAGGGCGAGGATTTGCTGGGACGATG
GTGCTCCGTGTCAATTTCCAGGAAATCACGTCCATTCTTCCGTTACAGCAATTGCTTCGACAGAAACCAGCAATGAATACTAGACAAGGCAGGCTCGTCG
TCGTTGCACTTGGATGCATTGGTCTTGAGGTGAGATCTCATTGTATGGCGCGTTTTTGCTGAAATAAGTGGCTCGCTCATCTGAATTGATTCTACCCCTC
TAGGAAACACTGCAGCCAGTGATGAGAGTATCAATCAATGGGCAAGATGGAGATATGCAAAGTTCAGATGTCGCTGTGTGGCGAGAACACTCGCTGTCGC
CTGTTGCTGCTGCTTCGAGCATCGCTGTGCCCGTTTGGCAACCAGCGATCCTTGTGTGGAACCACCAGTTCAGCTTTGATCTAGATGTGTCGTGTGCCGA
GAGCCATGTGATCTCGTTCACAATCACAGACACAAGCAGCTCTTCCAACTTGGATCTTGCCAGGAACCAATTGAGGATCACGGAGTGGGAGTCGCTGGCA
TCCTTCGATTCGTTCGACAACAAGCTTCTGCCCATGCATCCAGCAGCTTCAGCACATGGAACTGGCGATTTCAACAGCCCCGATGGAGAAATCCAACTGC
TGCTCGCGTGCTGTTGGCTCCCAGCTCACGAACGCGAAAGAACCGAAGGAAACGACAGTTCGTTCGAGGAGACAGCTTTGGTGAGAGAAGTCCAGAGATC
AGATGGCGTACCACAAAGTATTCTACTAGGAAGCACCATCGAGATAGCGATCCGTGGGATCTGTCGTGTACCGCAAGCACTCCTGGATGCCATCATGTCC
AAACTTGATAGTAGCCACACTTCCCAGCCTGGAAACAGAAAAGATCTGGTACTCAAAGGTCGGCTCTTGCCTGGTGGTAGCACCTCACAAATCGCCATCC
CCATTGAAGCGAGTCAAATCGATACCAAGCACTGCGAAGACTCAATGTGTGTTCAATTTACTCCTGATAACGACGACAAGCATGCGCCGTGTCTTCGCTT
TGGATTGGCGCCAACGGTGTTGAGTGCGCTGCAATCGCATACTGATGCACTTCGAGTTTATGTAGACGTACAAGTAAAGCGCTCGCGAGGGTGGAGCCTG
TCCTGTTGTATTGGACTGACGTCATTTATACGTGAGTTCGCGCCGACATCATGTGGCTGGCGATCCTCATTCAAGTTGCGCAACCAAGAAGACACAGAAA
TGGGTGGAAGGATTCGTGTCAGTGTCTTGTGTAGGGAACCACAAGCGAGTGATCAAGTGCGTAATCATCCAGTCCAGAAGATACGTTCTATTGAGACCCC
ACACGACAGTGCGATCGTGAAACTAGAGATCCAGGGTCTCAAGCCGTCCAACACCGTCGTGAGCTCGTACACGCAGCTTCTTGTGAAGATCTGGTCCAGT
AGCTATGGTCGTCGTCACACTTTCACATCCTCAATCCTAGGTTGGGATGGGGCTGCTACTGCTGCTAGTGGTAGCAGTGGAGTCTCTCAGAAGGCATCGA
CGCAAATTCACGTTCCTAGTGTCTTCAGTGAGGTATTTTTCATCGAAGTTTACCGCTACAGCCATCGTGAACGCAATGAGAGAATCGGAAGCTGCTCATT
TTCGCTGCCAACCACTGAGAAGAAGCAGACTCTGTCGGCGGTGGAATGGATGTCGCTGGTGGCACAGGAAGTCGGAGATGATGCGGAGATCTGCGCTGAA
ATACGCATGAGTGTGCGAGTGGAGCCACTAGACGCGTCGATGATGGCGCTTGAGGCAACGCAGATGTTGCCGCAACGAATACCTACTGCTGCCTCGACGA
TCTTGAGTGATGTCGTGTGCTATTCGGCTTCTGCAAATCGAGCTGAATCAAGTCATGGCCGATTGGAAATTGACTTGGTCGAAGCGTATCCGCTGAGATC
TCTAGGTGGCTCTCTGTGCATCCGCTTTCGAATGCCTTCTGCGCAGTGGAGTACTCGATCAAGATTCCAGGACTCAGTGACGCGACAACGTGGTGGGCGA
AACAGCAACGAAGCAGTAGTCGTGCCATGGA