Description :
From Genome Similarity Track
Location :
Scaffold_140:16271- 17880
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_140-fgenesh-gene-0.6GTPase

Sequence
1609 bases(100 bases per row)
CTCTTGGTGGATTTTACGGCTTCTTCACGACGCTCACAAAGCCGCTGGTCGCCGAAAAGTACTTCTTGTTGGCTTCCTCGACGCGCTTCTTCATGACCTC
TGGATTCACGAGCTCAATGCCCTGAACGGGCGTGAATGCGAGACTGGACGCGAGTCCAGACATGGGTGCCGCCTTGGCCGCCGCCACACTGGCCTGGCGG
AGCTTCTTGGACGTCTGGCGCTGTTCCTTGCGCTGCACTCGCAGCGTGCCCGAGCCTTCCTGGCCCAGGCGACCAGCGCTCAGTCCCATGGCGTTGTCAC
CGTATTCATCGTCGGCGGACGCAAACGTCTGGCGGTTCACTTCGCGTCGCACGTCCGTCATTTGGAGCCGCTCCTTCATCTTGCGGTGCCGCTTGCCGCC
GCGCTTGCGCTTGGGCTTCTCATCCGGGATCGGCAGGGCCTTCTTCGTCTTGGCCTTTTGCGGCTCTTCCCACTTGGCAATTTTCTTCTCGAGCTCGTGG
CGAAACTGGATACCCGTGCGCCCAATGAGGTCCGTCTTGTGCGGTTGGCTGTCGACGCGCGCCATGAGCGCGAGCTTGCCGGCGATCGCACGACACGCCT
TCATACGCAGGTACGGCGGCACGCTCTGCACAAGGTCGGCATTAAAGATCACGCCCGTGTGCTTGAGCGCGGCGGCCGACGAAAAGCCGCTGAGCACTTT
GCGCTGCTGGCCGAGCACTTGGATATTACACGACGGAATGCGTGCGAGCTCGGCGACACCGCCAGCGAGACCCACGAGCTGCGCGGCGATGCGCGTGCCT
ACGAGCTGCGAGACGTTGGGCGCGAGGTAGTTCATGCGCGACTCGACAAAGCCCAAGATCATAGTCTTGTCGTCGACCAGCGAGAGCAGTTCTTCGCAGG
CGCGGAGACACGTGGCGAGATCGTGCGGCGCCAGTGGCTTGCCGCTCGTGGCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCGAGCGTCATGTCGGTCTCGTTGCCGATCGCCTGGACGACGCGCGCATAGTCGACGGCGTTCGGCACGAGCGAGTCG
AGCTCGGGGAACTTCTGGCCGTAGAGCTCCGCGATGAACCGGTGGATCGCCGCGAGCTCGTCGTCGATCTGGACCATGAGATCGTTCGACGTGACCACGA
GACTGTACTCGGCGCTCCCCTCCACGAGCTCGTCGCCGCGGATCGGCGCCGTGCGGTCGGCGTACTGCTGGATGGTCTGCACGTGGTCCAAGTACTTTGG
CGACCGCTTCAAGTGCGCGATCGACTCGACGCCCTTGCCCTTGGCCGCGGCCTCGAGCACTTTGTCCAGGTCCTTAATCGCTTCGGGGCGCTCCGTCTCG
GCGGCAAACGCCGCGCCGTCCATGGCGTCGTCGTCCTGCTCGTCATCATCTTCTTCCTCGTCCTCTGGAACGCCCTCCAGTCGCCGCTTCTTGGACCCAC
GGGCCGCAGCCTCTTCGGCGACGCCCACGAGCTCTTCCTCCTCGCCGCTATCGCCGCTGAGGTCGTCCAGGTCGTCTAGAAACGAGTCCGCCACGGATGC
CATTGCTGC