Description :
From Genome Similarity Track
Location :
contig_15:162674- 166705
Transcript NameFunction/comments
g3368.t1hypothetical protein

Sequence
4031 bases(100 bases per row)
ACCTCTCTTTCGACAGGTTGGACGTCGCCATAGCGAAAGCACGGCGCAGAAAATTGGGAGAATCAACGACATCTCGCCCGTAATTTCGAGCGTGATCACC
GCCACAGAGACGGCTCGCGTCGCAGCGCCTCCAAACGCAGCAGCTCCAGCGAGGGCATACGCGCCCGGAGTAGCTCCGATGCTAGGGAATACGGTTGATA
GCGCTTCACCGAATAGCCGGCCGAAGGCAGCGCCGCCGATGAATGTAGGTACCACACACCCGTCGGCATCTTCACCGAGATGCACACTGGCAGCAAAAAC
ATAAAGATCGCTGGCCAAAACGGAGAGCGTGTAAAACTTTGACAACTTGTACCAGGAGTCTGGGAGATCCGCTTCGGTGAACAGCGTCGACAGCGTGTAA
ATCGTCGTGCTATGCGCAAACTCGCCAGGAACGTAGGTTAGAGTTCCACACAACACAGCGACGGCCACAGGATCAATCCACTCAACGAGTACTTTTTTCC
AAGTCCGCGATGACTTGCGCAGATCTCGTCGAGTCTCAGCAACGACTCGCAAGAGTTTGATCATCGCCGTGCACAATAGTCCTAGAACCGCCCCCAGTAG
CATGTAAAGCGGGATCTCCCAGATAGAGAATGGGCTCTCGCCGAAAGACGTGGCCAGAATCGCCGTGGTCGCTTGCTTAGAGGTGCTTTTCGCCAACACC
AGCGTCAATCGAAGCATGACTGCGCCGGAAACAGCACTGACAAATGCCTTGACGTAGTTCGACATGAGGTAGTAGGTCGCCGTGACTTCCATCGAGAACA
GAACACCTCCGATTGGCGACGAAAACAGAGATGACACACCAACGGCGCACGCTGCAGCCAGGAGCTGGATCCGGCCATTGAGGTGCGAGCTAAAGCCGCA
GTAAAGTGGCGATCTCAGGAGGTGGTGCGTCACAATCGACATGATGTGCACGTACGCACCTTCAGTGCCTACCACCAAACCAGCACCAACCGAGCAGATG
AGGCCCAGGACTTTTACAACGAGGGTGGCAAAGTCGAAGTAGCCAGGGAGATACAACCGCGGGTCGATCCCTGTCAAGATTGCCTTCATCTGCGAGACAC
CAGAGCCTTGACAGAGACAAATGTTAGACACACCCACTCTCGAACGCTCGTACTCGCCCACCACGTGTTACCTGCTGCCACAGGTGCAATCCGTGTGATA
AGAAGACCCACCAAGGAGAAGACGACAGTGTGACCCGTCCAAATGCAGTATCGAGCTGGTTCCGACGTCGTCTGCCCACCATCGTATCTCTCAAATCCAG
CAGCTCCTGACAAACACTAGACCGCAGCAACCCATGAGCCACCCCGCCTGCCCTCCCCTCACCACAGACTCCTGTACGCACCTCCTGATCCCGTAGTTCA
GGGGCCCCCAATGACCCCAAGAGCACCAAAAAGCTCACCGCCTTCAGCTGTCGACGGTAGAATTTCTGCTTGTTCTTAGCCCGCTCCCGCTCTCCTCCAA
ACAGCGAGCCGCTGGACATTGAGCGTTGCGCCGCATACTTGCGGAAGGCGTCCAGGAAGTCCGCGTCTTCGCTTCGAGCGTCCACATCCACTAAATAGTC
CCCAATGGACCCATTGTCCTCCAGGTGGTACGACTCGGCGCGCTGCTGAAACTCGTGGAGACTCGCGATTCGCCCCGTGCGGCGCTTGTGAGCAGGCAGT
AGCTGGTCCTCCAGTCCGTTGGCGGCGGACACCATGAGCGTGGAGAACAAATACTACCCCTGAACATGTCCCATGTCCATCGCTTTGGCCGATGGCCATG
GACTCGCTCAGTGGAGGCAAAGGGCGAAATGAACCATCGCCTGCGATCGCAGACGGCAACGACATCGGAGAGAAACGGTGACCACCTGGCATGGATCGAC
TGATGAATGGAATTCTAGTTGCATGTACAAGTAGACCGGTACAGTCTGTCGAGTGAAAGCAAACATTTCAGGTCCGATTGGACAAAGCGTGAATGATACA
CGTACGTCGACCTCCTCGAGCAGCTTTCCATTCTATCCATACTTGTACGCGTTACCACAGGTAATCGTCGATGGCGTGAGTGTCTTCAACCTTGTCGAGC
GGATCCCATGATTCCGAAGCACAATGGAGCGTGAGATCTTCAAAGTTTGTGCACTTCAAGCGTCGTCGACACGGTGTCGGAGTATTAATCACCCTTGAGT
TGACCACAGTTAATGGGTCCTACAGCACTTGCAAGAGTCTCGGTATTGGTCCAGGACTGCTGTGCACTGAGGTTCAGTCGGTCTATTTACAAGTTAGTTA
GGGAACCCTCTTGGGTCTTGAACAAAGAGTTCAATGCATGCGTGGAGTCGAGCCCCGTGTCTGGCCTTCGGTGTTTCTTGACGGACCCCTGCTTCCCAGA
AACGAGCTGTCAATGACTGACTCTCGAAACACGACGTCATTTCTCACATATTGATTGACACAACCGTGCTCCTGATGTGCCAGATCCGCTTCCATTCGCC
GTTGCACAGTCGTCCTGAAATCGTTCGTGTAGTTGAAGGGGTGGGGGTTAAGAGGTCCGCTATTTGTGTTTAGCTAAGAAACTTTAGTCCTGGTATCGCT
GGAGGCTTTGATTTATTGATAAACCATTCTGTGGTGTATTGTCGCAGCTAGTTTGCTACAGCTCTTCTTGTATGCGGATCCGAAGTGTTGCAGGTACGCT
GTCGTGGCGGAGCACCTCTTTCGTATATTTTGCCAATTGGTGCGACTTGAGTAATGCTGCAACTGCTTTTTGTAGTGTCTTGTTTGTGGTTTTCCAAAAA
CAGTTGATGCAGTATCCACCACGATCGCTTTGATGCTCTGGTTCGCTCTTGCAGGCCCCTTGGTGGACTTTGGCCCAATAAAACCCAAACGCCTCGCTTT
CCTGGTGCATCTGCTCGTTTCACGGAGTGAAATAGGACATGCCAATCATGCAATCACCATGAACACAGCATACCTAACATTGAGGACGCGAAAACCTACT
ATTTGGATTGGCGTGTGAGATGTCATTCCCTGAATCGCTGCTTGAGTCTGGAAAACAACAGCCACTTTGCTTTCTGTGCTCGCTGTCAAATATCTCTCGG
TTATGGATTAACCATAGCGTGCACTGAGTGCACGTTGTCCATATGATTCAGATAACTTGCATTGCCGCTTCATTGTCCTCTCCCCAGTCAGAGCTGTCCG
TTCTGGGACGCTCGTGCTCCCGTCCAGTGGCTGACTAACTTACTCCAACTTGCTACTGCGCTCCAACAGTCCAGAAGATATGGGCCAAGGTCTCCTTCGT
GCCCGCGCGTTCAGGCGTTTTGGAGCAACTGTTGCCTGTCTTACGACCTGGGTGATCAAGGATGAGTTGCGCCGTGGCGACTCGGCATCTTAAGGTAAAC
ACGTCTCGTGAAGTGCAGCACAGCTGGTTCCTCGGAAGTGCTGCTGTGTATGGCCGACGAACGCGAGAGCCTGTTAGCTGTAAACCGGACGGTCGTGATT
TCACGTCATTGGAGATTGCATGAACTTGGACCGCATCATTGGGTGTAATAGTACAGGTAGAGCGCTTTCATTCCTCAATTTACCTCGTCGCTACGGTACC
AAGACTCTCCAAAGCGTACACGCACGTACTACGAACTCGACATGAAGATTGTCCAGGCTGTAATCATCGCGGCAGTACTCTGCGTGGTCCAGGTTAGCGC
TAAAGCTCCCAATGACGACGACCCTGCCCGCGGCCCGTATAACCGCGGGAAAATAGGCGGGTGGTCTGTGTCTCCGGAAGACTAGAGAGCTCAACGTGCT
CTCATGCCACCTGACACGTACACGAAATCAACACGAAGTCGCTGGAAACTTGACGCCACTTTTCATTTCCCTTTCAAATACTTTTTGGTGCAAGGTTTTC
GTCGCTCACCACATCGACGCGGGGTCAGCCAAACTCGCCAAGCCAAGTAAACACATGCAAACGCCATTCTATCGAGTACTTTATGCGGCGCTGGAGAACT
TGCCTGAACGTAGCAGTCCTTTCGTGGTGAC