Description :
From Genome Similarity Track
Location :
contig_15:162662- 166709
Transcript NameFunction/comments
g3992.t1RAW26726.1 hypothetical protein PC110_g16874 [Phytophthora cactorum

Sequence
4047 bases(100 bases per row)
CGCTCGGACGAAAGTCTTGAGGTGCGTTGAGCTCACAACGCCCAACAAAACCATGGATTTATCGTCCTGGACAACGGGGATATTCTGATTCGGGAGACGA
TGGAGTGCCAGCAACAGCTTCGCCACGGTCGTCTTCTTGGCGACGTACACGGTGAACACCTCTACGATTCCCGGCGCACGCGTCTGGCTCAAAGTCCATA
ATCGGGAGGAATGGAGTGCCGCTCACTACCAACATCGTATCGTACACAGACCTCTCTTTCGACAGGTTGGACGTCGCCATAGCGGAAAGCACGGCGCAGA
AAATTGGGAGAATCAACGACATCTCGCCCGTAATTTCGAGCGTGATCACCGCCACAGAGACGGCTCGCGTCGCAGCGCCTCCAAACGCAGCAGCTCCAGC
GAGGGCATACGCGCCCGGAGTAGCTCCGATGCTAGGGAATACGGTTGATAGCGCTTCACCGAATAGCCGGCCGAAGGCAGCGCCGCCGATGAATGTAGGC
ACCCACACACCCGTCGGCATCTTCACCGAGATGCACACTGGCAGCAAAAACATAAAGATCGCTGGCAAAACGGAGAGCGTGTAAAACTTTGACAACTTGT
ACCAGGAGTCTGGGAGATCCGCTTCGGTGAACAGCGTCGACAGCGTGTAAATCGTCGTGCTATGCGCAAACTCGCCAGGAACGTAGGTTAGAGTTCCACA
CAACACAGCGACGACCACAGGATCAATCCACTCAACGAGTACTTTTTTCCAAGTCCGCGATGACTTGCGCAGATCTCGTCGAGTCTCAGCAACGACTCGC
AAGAGTTTGATCATCGCCGTGCACAATAGTCCTAGAACCGCCCCCAGTAGCATGTAAAGCGGGATCTCCCAGATAGAGAATGGGCTCTCGCCGAAAGACG
TGGCCAGAATCGCCGTGGTCGCTTGCTTAGAGGTGCTTTTCGCCAACACCAGCGTCAATCGAAGCATGACTGCGCCGGAAACAGCACTGACAAATGCCTT
GACGTAGTTCGACATGAGGTAGTAGGTCGCCGTGACTTCCATCGAGAACAGAACACCTCCGATTGGCGACGAAAACAGAGATGACACACCAACGGCGCAC
GCTGCAGCCAGGAGCTGGATCCGGCCATTGAGGTGCGAGCTAAAGCCGCAGTAAAGTGGCGATCTCAGGAGGTGGTGCGTCACAATCGACATGATGTGCA
CGTACGCACCTTCAGTGCCTACCACCAAACCAGCACCAACCGAGCAGATGAGGCCCAGGACTTTTACAACGAGGGTGGCAAAGTCGAAGTAGCCAGGGAG
ATACAACCGCGGGTCGATCCCTGTCAAGATTGCCTTCATCTGCGAGACACCAGAGCCTTGACAGAGACAAATGTTAGACACACCCACTCTCGAACGCTCG
TACTCGCCCACCACGTGTTACCTGCTGCCACAGGTGCAATCCGTGTGATAAGAAGACCCACCAAGGAGAAGACGACAGTGTGACCCGTCCAAATGCAGTA
TCGAGCTGGTTCCGACGTCGTCTGCCCCACCATCGTATCTCTCAAATCCAGCAGCTCCTGACAAACACTAGACCGCAGCAACCCATGAGCCACCCCGCCT
GCCCTCCCCTCACCACAGACTCCTGTACGCACCTCCTGATCCCGTAGTTCAGGGGCCCCCCAATGACCCCCAAGAGCACCAAAAAGCTCACCGCCTTCAG
CTGTCGACGGTAGAATTTCTGCTTGTTCTTAGCCCGCTCCCGCTCTCCTCCAAACAGCGAGCCGCTGGACATTGAGCGTTGCGCCGCATACTTGCGGAAG
GCGTCCAGGAAGTCCGCGTCTTCGCTTCGAGCGTCCACATCCACTAAATAGTCCCCAATGGACCCATTGTCCTCCAGGTGGTACGACTCGGCGCGCTGCT
GAAACTCGTGGAGACTCGCGATTCGCCCCGTGCGGCGCTTGTGAGCAGGCAGCAGCTGGTCCCCCAGTCCGTTGGCGGCGGACACCATGAGCATGGAGAA
CAAATACTACCCCTAAACATGTCCCATGTGCATCGCTTTGGCCGATGGCCATGGACTGGCACAGTGGAGGCAAGGGGCGAAATGAACCATCGCCTGCGAT
CGCAGACGGCAACGACATCGGAGAGAAACGGTGACCACCTGGCATGGATCGACTGATGAATGGAATTCTAGTTGCATGTACAAGTAGACCGGTACAGTCT
GTCGAGTGAAAGCAAACGTTTCAGGTCCGATTGGACAAAGCGTGAATGATACACGTACGTCGACCTCCTCGAGCAGCTTTCCATTCTATCCATACTTGTA
CGCGTTACCACAGGTAATCGTCGATGGCGTGAGTGTCTTCAACCTTGTCGAGCGGATCCCATGATTCCGAAGCACAATGGAGCGTGAGATCTTCAAAGTT
TGTGCACTTCAAGCGTCGTCGACACGGTGTCGGAGTATTGATCACCCTTGAGTTGACCACAGTTAATGGGTCCTACAGCACTTGCAAGAGTCTCGGTATT
GGTCCAGGACTGCTGTGCACTGAGGTTCAGTCGGTCTATTTACAAGTTAGTTAGGGAACCCTCTTGGGTCTTGAACAAAGAGTTCAATGCATGCGTGGAG
TCGAGCCCCGTGTCTGGCCTTCGGTGTTTCTTGACGGACCCCTGCTTCCCAGAAACGAGCTGTCAATGACTGACTCTCGAAACACGACGTCATTTCTCAC
ATATTGATTGACACAACCGTGCTCCTGATGTGCCAGATCCGCTTCCATTCGCCGTTGCACAGTCGTCCTGAAATCGTTCGTGTAGTTGAAGGGGTGGGGG
TTAAGAGGTCCGCTATTTGTGTTTAGCTAAGAAACTTTAGTCCTGGTATCGCTGGAGGCTTTGATTTATTGATAAACCATTCTGTGGTGTATTGTCGCAG
CTAGTTTGCTACAGCTCTTCTTGTGTGCGGATCCGAAGTGTTGCAGGTACGCTGTCGTGGCGGAGCACCTCTTTCGTATATTTTGCCAATTGGTGCGACT
TGAGTAATGCTGCAACTGCTTTTTGTAGTGTCTTGTTTGTGGTTTTCCAAAAACAGTTGATGCAGTATCCACCACGATCGCTTTGATGCTCTGGTTCGCT
CTTGCAGGCCCCTTGGTGGACTTTGGCCCAATAAAACCCAAACGCCTCGCTTTCCTAGTGCATCTGCTCGTTTCACGGAGTGAAATAGGACATGCCAATC
ATGCAATCACCGTGAACACAGCATACCTAACATTGAGGACGCGAAAACCTAGTGTTTGGATTGGCGTGTGAGATGTCATTCCCTGAATCGCTGCTTGAGT
CTGGAAAACAACAGCCGCTTTGCTTTCTGTGCTCGCTGTCAAATATCTCCCGGTTATGGATTAACCATAGCGTGCACTGAGTGCACGTTGTCCATATGAT
CCAGATAACTTGCATTGCCGCTTCATTGTCCTCTCCCCAGTCAGAGCTGTCCGTTCTGGGACGCTCGTGCTCCCGTCCAGTGGCTGACTAACTTACTCCA
ACTTGCTACTGCGCTCCAACAGTCCAGAAGATATGGGCCAAGGTCTCCTTCGTGCCCGCGCATTCAGGCGTTTTGGAGCAACTGTTGCCTGTCTTACGAC
CTGGGTGATCAAGGATGAGTTGCGCCGTGGCGACTCGGCATCTTAAGGTAAACACGTCTCGTAAAGTGCAGCACAGCTGGTTCCTCGGAAGTGCTGCTGT
GTATGGCCAACGAACGCGAGAGCCTGTTAGCTGTAAACCGGACGGTCGTGATTTCACGTCATTGGAGATTGCATGAACTTGGACCGCATCATTGGGTGTA
ATAGTACAGGTAGAGCGCTTTCATTCCTCAATTTACCTCGTCGCTACGGTACCAAGACTCTCCAAAGCGTACACGCACGTACTACGAACTCGACATGAAG
ATTGTCCAGGCTGTAATCATCGCGGCAGTACTCTGCGTGGTCCAGGTTAGCGCTAAAGCTCCCAATGACGACGACCCTGCCCGCGGCCCGTATAACCGCG
GGAAAATAGGCGGGTGGTCTGTGTCTCCGGAAGACTAGAGAGCTCAA