Description :
From Genome Similarity Track
Location :
Scaffold_521:1626- 3370
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_521-fgenesh-gene-0.0Peptidylprolyl isomerase domain and WD repeat-containing protein 1

Sequence
1744 bases(100 bases per row)
GCACTCACAAGAAAACGGCTTCTTCCTCTCCCGACCGCCACGAAAAAACTTTCGACGCTCGTGGCCACGCTTGTGCAGGCCGTCCACGAGCGCCACACCA
AGCACGACGACCTCGTGCCGGCCCGCGACGGCACGTACGNNNNNNNNNNGTCGACGCTCGTGGCCACGCTCGTGCAGGCCGTTCACGAGCGCCACGCCAA
GCACGAGGACCTCGTCCCGGCCCGCGACGGCACGTACGCGACCAAGAAGCACCATTTAGCACTCCACTTGCACCACTTTGGTCTCGGCGACGCCAAAATG
GATGCGCTTTCGACATCGCTCCAGCATTTCCAGTCGATTCACGTCTTGGATCTCAGCGATAATCGACTCACCGACACGTCGATCATCCCGTTGCTCGAAT
CGCTGGAAGCTGCGACGGCGGAAGGTTCAGTATCCTCGCCCCCACTGCGACCGCTCTCCAGTGGAGGGTCTAGTCGAGGAGCAACCCCGATCTCTTCTCG
ACGCCGCGGCAATGACCTGCGCGTCCTCAACTTGAGCCAGAACGACCTGGGCGTGGCGGCGTGTGCTCAAATCGCCACTTTTCTGGGCGTGTGTCCGCAG
CTCACACATCTCGATTTGTCCCACACGAAGCTCGGAGGCACAGACGCCGTCGCACCGCTCACGAGCGCGATAGAGACCCACCGGTCACTGCGAGTTGTCA
ACATGGCCTACAATACGATCGGTGTCTTGTGTGGTGGGCTGCTTGGCGACATGCTCTCGCAGCCGTCATGTGCAGTCGTCGAGCTCGACGTTTCGTGGAA
CAAGATTTGCAAGAGCGGCGCGATCGCGGTCGGTCGCTCACTGCGCACTAACACGATGTTGTGCAAGCTCAACCTCGCGATGAACCGGTTCTCGGACGCT
GGCGCCGAGCAGCTCGCGTCGGCGCTGGCATGCAATGCGACACTAACGGATCTCGACCTCTCGCGCAACAATCTGGGCGGTCGAAGTGCGATCGCTTTTG
CGTTTTATCTCCGCACGAACCGGTCGCTGCTGCATCTTCGCCTCGAAGACAATCCGATTGGCGCTACGGGTGCCAAGGCTCTACTGCGGACCGTGTCACT
CGGCTCACCGTGTGAGTTTCACGTTGCGGCCCATGATATTGAGTCACCCAGTGGCGAGAAGGATCCAATCTTTGATCGCATGGTGCCCTCGATGCTGTCG
CCATTTACGCTTTCGACAGGCGCCTCGCCCTATGCGTTTGCCGTCGCGAGCGAACTTGTGGATGCAGCACTGCAGGACAGGACGTGCTCGCTGTCGGAGC
TCTCGTTTATTGACGATCGTAACCCCAAGAAACCGGTGACCACGGCTCTCTCGGTCGATGAATGCCGCAAGACGCTGGTCGAGACATTGACCAATAAGCC
GTGGATGCTTCCACGAGACTATGGCGTCTTCCACACGAGCGTGAGCTTTTCGCCCCCGCCGATGCGCGTGACGCCGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCATCTCACTGTGACGTCTTGTGAGGCGTTGATCCGCATTATCGAGCGAGGCTTTTCGTCTCGCGAGAAGGCGAGTCTGCTTGCGCTTG
CCGTAAACGATTTTTACCTCACGACCGACTTGGCCGATCTCTTTGTCGAGAAGCTACGTGGTGTGATCGATGTCGTCGAGATTGTCGGTCGCCTGTGGCA
GTGTCTTCTGGACGGCGATCGCGTGTACCGGTTTCTGCAGCGCC