Description :
From Genome Similarity Track
Location :
scaffold_581:1626- 3351
Transcript NameFunction/comments
Pl_103664hypothetical protein PHYSODRAFT_329735

Sequence
1725 bases(100 bases per row)
CCGTTATTGTCGTTGTTGATCAGCTAAACGTAGAAACTTCATCAGGAACTTCCTGATGACAAGAAGTCAGGCGCTATGTAGTGCCTGGAAAACTCGAAGC
ATGCCTGACCTCAATGGATCAGGCCCTGCCAGTACAGGCGTGCTAGTACAGGCGTGTCTGTCTGAACATCAACGGAGTCAGGCAGCGTTAGTCAGGCGAT
GTAGCCATCTCAAACCTGCAGCACTCGCTACACTCTGTGATCAGGTAGTATCAAGTATGCTTGCGTTAGTTAAATTAAATACAAGCCTCTCCCAGACTTG
ATGCGAAACGTCCACCCCACGCAGACATTTTCTTCAACTTGTAACGGCCGTTTTCAGACATGTAGCCATCAGATCTTCAGAATGCAGCTACTTCATTTCT
GAATTTGCTTGTAAGTCCCCACTCTTCCCTTCTCCACTATGAACGACGTCAAGGCTTTTGCTCTGAGTGCTGCTGTTCTCTACATTAAGTTCCTGGCCTC
GACCATGATTCAAGGACGCAAAGCTTTTGCTGCCAACACGCGCATGCCTGAAGACAAGGCTCTGGTCTGCAACATGGGACTCAAGCTCGACATGGACGCA
AAGGCTGTCAAGGCAGCGGTGGAAGATGAGATGCGTTGGAAACGCATCATCCAGAACGACCTCGAGTCCATGCCACTCGCCTTCGTGGTCTTCTGGAGCG
CCATCACTGTGGGTGTCAACCCCATCATTACCAAGACCCTCATGCTTGTCTACACCTCCGCTCGTGTCAGTCATACAGCAGTCTATTCGTTAGGAATGCC
ACAAGCTCGCATGGTATTCTGGATGGCTGGTAGCTTCTCCATTGTCGCTGCCGCACTCAATGCTGTAGTTGTAGCACTTCAGTAACTTTTCAATTCAGAA
TTCCTTCGACTTTCATATCAGTCCATCGCAGATAGAAACAAATCAATCGTTTTGCATTGAATATCGTCGTCTTCCTACTCTAACCACGTCGACATTGAGT
TACTGCACGGAGCATCCCCATCCCTCTGGTTCCTGACCAGGTAAGTAGTGTTTGCCTGTCTTCCATTCGGGACAGCGGTCTTCCTCTTTCACACCTGACA
ACAACTCAGTGAGACATCATTGTGTAGCTTAGCTTTGCAGCTGCAACGCACCATTGAGAGCGCTCTCGATGTGCATGCCGCAGCCCCTCCACGTGGCTTT
GTGGCAGGTCGAGCACTCGGTTTTCATGCACATTCTGGCAAGTCACTTGACACGCACTTGGGGAGTTCGAGAATGAACTGCTGACCCGGTTTCGTCCAGC
TAGTGCCTGACCTTGGAGTCCTTGGTGGATGTCAAAGTCAGGCACAGCTATGCCTGACGTGGATGCTGTTCCGTAGTTGCAATTCCTATGGGATATGCCA
GGGGAATGCCGTAGTCAAGTGTAGCACTTCAACTTGTCTTTATTGCAATCTTATAGCGATATTTAATGCTGGCCGGTCTTCCATTGTGGGCATCGATCCT
CTTCCTTTACGTCTGCATTGTCACAATGTTAGAATAGTATTTTATGAACGCAGAGTTATAGACGCACCGTTGAGAGCAAGGTCGATATGGTTACCACAAC
CACGCCATGTCGCCTTCTGGCACGTAGGGCACTCGATCTTCACGCACATTGCAACGACTTGGGTACTAGAGTTGATGTCTTGAGTTTTGGCGAGTTCAGA
AATGAACAATGAGCCTTCTCTTCTT