Description :
From Genome Similarity Track
Location :
Scaffold_7:162570- 163595
Transcript NameFunction/comments
Physo_129220hypothetical protein

Sequence
1025 bases(100 bases per row)
TCCGTGAGCGCGCTGGCGAAGCAAGTCCGTGACGCGTCGTATGACAACGACCACGATTGCTGCTTCGTCCACTACGTTCGCAAATGTGCAGAGTGTCATG
GGTATAATCGCCCGCGACCTGACGAACCTGCGTGGGGGCGTCTTCTAGCTGCAAACCCGTTGACTGTACCCGAAGAAGGCTTGATCGCTCGATATCGTAA
GGCTGTTGATAACGCTAGGCGCGGCGGACGGCTGCGCCACGTCGAAGACTTGCCACCCCTCCAAGGGTTGCCTCGTACGCCGCCACGCAGTCTGGCACGT
CTTCCAACAGGACCTCGCGTGGCTCCCAACTATCCGACATTTGACCCAGCCAACGCACAAGATATTGGCCGTGCATGGGGACGTGGGAATCGCGGCCGCG
AGCGCCGCGATGCGGAAGAGCAACGCGTGGAGCAGCACGATGATCGTCGTGCTTCAAGATCGCCTCCACGATATGCCGAGCGTTACCCGCGCTATCCACA
AGAGGCGCGGGGCCGTCACGCGGAAACCGTGCAGCGTGACCGTCGGCAGGACGCGGAGGAGGAGCAGCGACGTCGGCGCGCTGCTGCGCGGCAGCAGCAG
CATCACGAACCGGATCGACAGCAACACGGGAGTTGGCGGCGAGGCCAGGCGGAGGAACAGCAGCAGCGTTGGGACCAGCTGCTGCGGCTGGAGTGCAAGA
TGGTTGCGCTGCGGGGCGAGCTGATTGGGGCGGCGCATGATCCGCCGAAGCACCGTGGTCGACGGGACCGTGCGGACGGCTGGAACCAGCGTCGCTGGGG
ATGACTGCGGAGTGATAACGTCGGAGTCGACCGACGTAGAAGGTGGAATGTAGGCGGATAGCAGACGGTAGTTGAAGAGTATAAGCATCGCCCAATACCT
TCGTAACCTTGAATGGTCCAATAAATCTTGGTGCGAACTTGTTCGCGCCCAGATTCGTAACCGCAGCAGTTTGAATACCAGTCGTAGAAGGCAATACACG
GTCGCCCACGGTGAACGTCTCCACA