Description :
From Genome Similarity Track
Location :
scaffold_12:16254- 25903
Transcript NameFunction/comments
g746.t1hypothetical protein
g747.t1hypothetical protein

Sequence
9649 bases(100 bases per row)
GGTCTTGGGAAAGCTTGAAATCCTGGAGGGCGTGGAGCCAGCCGATACAGTACTTGGATTTGCGTTGCTACATGACATCGGCAGAGAAAGTAGAGCAATA
ATACTCAACGCAGTCTGTGATGTGCCTCACGTAGAGTGCAAAAGGCGCAACGCTTTAATGCACTCGAAGGGTGTTACGGGAGATCGAGGGGTACAAATAG
GGACACTTGAGATATACGACGATGTGGAGCCCGTGGATCAGATTTACAAATTTGTGAAAGATCACAAGTTACCGATGTTTGCGGTGGAACAATTGCTGAA
TGTGGTATGCTCGGCTATTGGCGACGCTCAATGTACGCAGAAGATTCCCTTAGTGTATTCGCAGCGTGTTGTTGTGAAAGATGACGAGACCGGAGAGCCA
CGACAGCTTGGAATGCTTCAAATTCCGTTAGGCGAAGAGCCTGCAGATGTAGTGCACAACTTTGGTTTGCACTACGGATTGGCAAAATCATTCCGGCAAG
ACTTAGTGAGGAAGGTGTGTGGGGACAAGTATGTCGCTTGCAAGCGCTTAAAGCCGATTGTCTTTGCTTCCCCTGTGGAAGTAGAAAATGGGACAACGGT
GGGTGTGCTATCGATCCGAGAAGACGAAGAACTGGCCGATGCTGTGCGCAGGTTTTCGAGGCAAGTGAACATCACTCGAGACTTGCAGATTTCGTTGTTC
CGGGCGCTGTGTGGGACGCGAGAAGGGGTTCTTTGCACTCGCGGCCAGGCACTTCTGCGATCGGTCCCAGTCGGTGACAACAGTGGGCAGATTTTAGGCT
ACGTCGACATCTTTGATGGTCAAGAGCCGGCCGATGTAGTATATCAATTTGCCGAGAAGCACAATCTCGCACCTGGGGACCGAGAAGTTTTGCTGGACAG
TTTGTGTAATTCCTCCATATCAATATCCGAGCAGGCAGAAGACGATGACGATGAAAAGGAACCACTTACGTGCTGTCGTTACGCTCCAGTTGTGTTCCAA
GTGCCGGTGGCTGCTCAAAACGGGTCCAGTCTTGGAATTCTAGAAGTTCTTGAGAATGAAGAGCCTGCAGATGCCGTTGCAAGATTTGGGAACAAACACG
AGTTGAATCCGGAAGAGAAGAAGAATATCGTTACTGGTGTGTGCCAGGCTAGTGGACTCGAGTGCACACGAGACGTTGGGATTCTTTACGAGACAGTCTA
CACTCTACCTGATGGCCAACGAGAGCGATTGCCGTTCTACGATGGTCAGGATTCCACCGACGTAATTTACGAGTATGGGCTGATGCGTAATTTAACCCTG
CGCCAACGACAGAAGTTCCTCATAGAAGTGTGCAATGAGCCTCGCAAGCGTCCGAATTGCACGCGTGCCGAGCCAATGCTGATGAATATCCCTGTGTGGG
AATCAGCCAGCTCAAAACTCGGGGATGTTCAGATCTTAGAGGGACAAGAACCAGTCGACGTCGTGTACGCGTTCATGGAGAAGCACGACTTGTTCCAGAC
CGCACCTCTCAATACAACGCTATTGGAAATCGTGTGCAACAATACTCGAGTCGAGTGCAACCGCATGCAGCCACGACGTACGTTGTTTTCCGTTCAAGCA
ACATACGCTGGGCTATCACACACACTGGAATACGTACGTCCTGAGTCGGACTGGATCTGCGAAACGGAGTCGCACGGTGGCCAACGCTGCATTCACTACG
TGGAAATCCTCGCTAAGAAGTTTTGCGCGCGACATATGTACGACTGGGCTGACTGTGAGGCGCGAATACTGGACGCATTGCGACAACAGCTCGAGTTCTA
CGAGGTGCGAATGTGGAAGGCCAAGGACATGTATGCAAAACTGGGATTGGTGAAGACGGCAAGTCGTGAGCAGATCGATGCAGCCTACAACACATTGGTG
AAGCGCTTTAACAACGAAACGGAGCCGTACAAATACGAGAAGCTAAAGGAGGCGTATCGAGTGCTGAGTGACCCGGAGGAGAAGTATTACTACGACTTAC
CATGCGTCAAACTCTTTGGCTGTTTGTGCGGCAAACGTCAGAAAGATGGCGGTATCACTTTCACCCCAGACTAAATAACACAATTGCCATTTGCGATCTT
CTCGTACTACGTGTATTGACAATTGAAAGGTCACGATGAAAGCGATGGGGGCCGCACATATCCGACGGATCCCATTCCGAAATGCCTCCAAATCACTCGT
CGCATTGAGGTGGGACTACAGAATATGAGCGACGCTGCAGCACATGAACTCTCAACGTCAAAACTACTTGTTGGGATCTCTAGTGGAGTGTCGCTGCTGG
GAGCGCTGGTGATGATAGCGCACTATCTGTTTTTTCAAGAGTCCCGAAGATGTGGACGACGATTGTTGTTCTGCTTGCATCTAGCGGACGCAGGGGCTGC
GTGTGCATGGCTTCTAGTGTTTTATCTGCCGAATCCAGAACAAGATGAAGAAGCGACGTCTGGTTTTCAAACATCTAGGATATGCACTACTCAGGTCTGT
AAAATATGTTTTTGAGTAAAACTGAGATTTACTCACTTGCTATTGGCAGGGCTATTCATTGGTATTTTTCCAGTTGGCGTCGTGCTTTTGGACTGGGTGT
TTTGCGTTCCACCTTTTTCAGCTATTGACACGGAGGTGTAAAGCCTCAGAACTGTACGAGAACCGCTATCACCTGGTGGCATGGGGGATACCCGTCGCGG
TAAGATGCTTGTGTAGTAGATCCGCTACGATTGCAATGATACTAATTATTCTTTGATCAAGACTGCGGCTCATTTATACATGCAGTCATGGTCTGGAACA
GATCTCGTTGGCGAAAGTGGACGACCCTGGTGTTGGATACGCTCGTGGAGTGACAATCAGTGGAGCGAACAAGCGTTCTACGTCCAGCTTGTTATTTTCT
ACGCTCCGGTAGTACTAACCTTCTTGCACAACCTCGCGACCTACGTGATGTTGCTGTATTTAATGGTGGGTGCTTTTATAACTATGTTCGATCGTTCCGC
ACTAACTTGTCATTGATAATGCTGAGTAGACCGACAGTGTATCCACCAGTATGGAGACTCGCATCCACTATCGCCTTCTCCTGTACAGCTGGGCATTTTT
CCTTCCGAACGTGTGGATCGTTTTCGCTTTCGCATATCAAAGAGTGACCCCGAATCACGAGCTCAACTCTTCAATTCTGTATTGTATCAGCTTCTTCACC
CCGTTCCAGGTACCGTGTCTAATGTTTTTCACGAAATATGTACAATACTTACTCTTTGGTTACTAGGGAGCGCTGAATGCAGTCGCCTACGGAATGAACC
ACTCGGTGAGTACTAACTCTAGGTCTTTTTATTCTATGCAACCTAATGCTGGTTTGCTCACTACAGTTCAAAGAACGAGTTGTACGAAGTTGTTGTTGTG
GGCGATTTTGGATGGATACATTTTCCACGTCATACAATAATTAGTGCAACAATAATTGTTGCGCACAATTATTTCCAATGGACGCAGAGTGCGGCGCGTT
GGTGGTGTCATTTCTGTCTTTGCGAGAGCGTCACAAGCTCCGCGCTGTAAGTCGCCGATGGTTGTTCACGTGTGTTTGGTTGCAGTTCAGCGGCACTGAC
GAGGACGACGTCCAGCCTAAAAAATCGGTCTGGAACCTCCGCAGTCGCACATTCCGTCACGACTGGACCACCTTCATGCGCAGCGAGTGCCAGTCGTTCC
TGCCACGTCTACTAGAGCGTCTACCTGCTGTTGCAATGGCAGAAACCATGGAGCTCAAGAAGGGGTTATGTCTGTCCACCAACACGGGACAACGACCTTC
GTTCGAGAATACCCACGCTCGCAGCGGCTACATCCAGCAGAAGATCAACCGCTGCGGAAACCTGCCCAATTTACTAGTATCGGAAGAGCTGAGCGAGCTG
AGATCGGAATTGTTTAGAGCCAAGCAGCCCACGTGCTGGAGCATGGCGTTATATGGAGGAGGCCCGGGGTATGACGCTATCGGACTCGTCTTTATGCGCG
AATATGTTCGCGCTTGGGACGTGAAATTCCACACCACAGTGTACGACAACGAGCCTGGTTGGAAATGCGCGATCGATGCAGCGACGCAGACACTGGAGCA
TCTCGGACAGCAAAACACATCGTTGAGCTTTCAACACTGTGATATTACGCTCGATCTGCACTCTGAGGAGAATGAACACGTGCGCCAGACACTCTCAACT
ACCCAGTTACATGTGTTTTCGTTTGTGTGCGTGGAGAACTTCTGTCTCTTGCTCGCCAGCGACTACGTGTTCCTACGCTCGCTGTTCGCTCAGTGCAGTG
CTGGCAGTTACTTCATCTGCACAGACTCGACGCATCGACTGTGGCCAGCCATCTTCGACGTAGCCAACGCCACTGCACCCGGTAGATTCCGTGTATGGAC
TCCATTTGCACGTAGTTGCCACTACGCACTCGTCCTGCAGAAGCTACCAGACTACTCGAAACCAGCATCCACATACCCGTTCTACGATCAAGCTATGGCC
AAACTCGACGATTTCCGACAGCATCAGCAACAACATCTCCAGACTATGGAAACACAGCAACCAGAGCCACAAGAACATGTACTTGAAGACGAGGGTATTG
GTCTACTGCTAGGGTAGCCATGTTTAATCCACACCAAATGTACACCATTTTGTTCCGCAAGCATCTCTACAAACCCTACACTTTTTCTTCCCAACAGCTC
CTGTCGACTGGACGACCACCCGTGCCGCCAGATAACTCCCCCGCTGACCTCTAGCAATGACCGAAGTGACGGTGTCTCGCCGCGACTCGGCGGCGTCCGC
GCCGGTGTCTCCCGACGAGATACTACAGAGTCTTCTGGCTGAGGAGACTGTGACGGTGTCAGCTTCCCTGGTCTCGGCGCTGAGCAAGGACGCGACGCTC
GCGCAGTTCATCGGCTTCATCACGCGCGCGCCAGACTCGAACGCTACGCTGCCCGACGGCCCTGACGCCAATAAAGTCGCCACAGCCGAGGATGCCGCGT
TGCGCCGCGAAGCCGAGGCCACAGATAATGTGACACCCGAGCTGCTGACGTCCTATCGCGCCACGATGCTGCTGACGAACGACGACACGGCGGACGCGCT
GCTCACGTTCCTCGGGGACAAGAGCAAACTGCTCACGCGCTGTCTGTTCCCCGTGTTCCAGAGCGACGCTAAGGGGAATTTGCGTCATGCCTGCCGCGTC
ATTGATCACCTCCTGCGCTTTTATCTGGATGATGTGTACGACGTACTGGGCAAGGACGCCGCTACCGTCCAGCGATACATGGGCGCAATGCTGCCGTACT
TGGAGCACGCACCCGTGGCTGAGCTGTTCCTGACGATGATTTGCAAGCCTCACAGCGCTGCGGTCATGAGGTTGTACCCCTCCACGCCACCCAAGAAGTG
GGCGTTCTTCAGTGCACTGGCAGAGTGGAAGGTGTTGCTTGTGCTCGCTAATCATGTGTGCAGTACCGAGTATGGAGAGACCCACACTATCGGAGCTGCT
GACGTGTTTGTCGAACTGCTGGACCGCCTTGCAGCCGATGAGAATGGACAATTGTTGCTGCAACCAGCTGCGTACTGCCCCGAGTTGGTCGAGGGGCTGA
TCCAGGCCGCTGTCGAGCCTGAGAACAATAAAATTCAACCTCCGCAGAGAACGGTGGGGCAGCGCACAGCTGCGATGAAGTGCGTCTTCCGTTTACTGCA
GAAAAGCGTACTGGAGAAGGTTCAAGGCCCGCCTACGAGTCCGTACCAGTCATTCGGAGCTACAATTGTGAACCTTGTGCCCAACCAGTTGGGTCCGCTG
CGTGAGAAAATCTATGAACTGGTAGAACAGCATCTCGGTGAGATTTTGAAGTACCTGATCCAGAAGTACGTGAGCCAGCAGAACATTGAGATGCCCGACG
AGGAGTCTGGAAAGCCACTACCTGAGGGTGCTGTTCGTCATACGGCCTATGTGGTGAAGGTTCCGTTCACAGAGTTGCGTCTCACGCTCGTAGAGGCCTT
GGTGGAGGTCATGGCGCACAACCCCCGATTGATGAGCGAGCACTTCGACGCAAATGTCTGGCGCGTTCTGGTCACGTGGTTCTTTGAGTATTCCCACAAC
AACCTGTACCACGCCGCTTTCTACCAGCTTGTGTTCATTGCTTTGCGTACAGACAATCAGCAAGCTCTGGAGGTGCTTGTGAAGAAGCTCAAGTTGGTGA
CGCTGCTGATTGAGCACTATCGTGCCGACGGCGACACTACCAGCAACAAGGGCTACATTTTGCAGATTTGCAACGCTATTCGACTGCAGGCAGCTTCGCA
GTCCCCTGAGGCGTTCTTGCGGAACTTCCTTCAGTCGCACACGACGTGGCGTGGGTTTGAGCAGGAGCTGCGTGACCAGACCAGTCTACTGTGCGTGAAT
GGCCTGGGCTTTACGGTGCCCCAGCCTATTCGTCCTGGCTATCAGAAGGACTCGTGGCAGATGCTGAGTGAAGAGCAAGCAGGCATCGACCATGGATCTG
AATTTGCGCGTTCTCTAGGTTTCGTAGACGACGTCGCATGGCCGGAGGACGACGTCACTGATGACAACAAGAAGCGAAAGAAAAAGAAAAAAGGAAAGCG
GAATTCCCACCACCCGAACGGCAACAACCACGACGTGGATGATGCGGATAGCACCGATGATGAGTTCACCGTTAAACCGGAGGATGCTGCTGCAGCAGCT
TTAATTGCAGCGGAGGAGGCCGAACTTGCTGTGAACGAGTCAATAGGCAAGATGCTTAACGGAGCAAGTACCCCCAAGAAGAAGAAGAAAACCAAAAAGA
AACACAACAAGAAATAGAGGTCTGCTCCGTTACTAACTGCTATGGGGTTTGTTCATGCACTGTGTTGTTGTCACGTGTAACATGGTTAGCTTGTGGCTGT
CTTTACCAACTGGACCGTGCACAATAAGCGGCCCTTGACCGGGAAGACAGTCGAAAGCTCGTAAGTCAAATCGAACGGGTCGTCGACGGTCTTGATATCG
AAGCGACTGAAAAGCACGGCAGCTACCATGCGTAGTTCCAACATTGCAAACCGCATGCCGATGCATTGACGAGGTCCAGCAAGGAACGTGACGAACTTGA
AAGGCGAGAATTGGCGCAAATTTCCTGTTTCAGGGTCGATCCATCGCTCAGGTTTGAACTCCGCAGCATCCTCGCCCCAAGTGCTTTTTAGCCGCGCGGA
AGCGTAGTGACACACATAAACGATCGAATCTTTCGGAATGAAAGTTCCACAGCTCAGAGTCGTGTCTTGGTTGGGCGAACGTGTGGTCATGCTGGTGTTT
AGACGCAAGTTCTCACGCATGGCTGCTTCGAGGTACGGAAGCCGAGCCAACTGCGGCTTGAAAAGCACACGAACACCAGAAAGCTGTGCTTGCTGGAACA
GCGTTTGTCGTCGTATTACTGGGTTGGAAGGTGCTGAAGCATACGCTGCGTTCTCCTACGCAAAAGGCAGCAGATGAAAGTTCCCGGCGGATTCATCGTC
CCCAGTCTACGTTGCCTCTGCTGGGCAACACACTGGACACCATGTTCTCGCAGAAGGAGCGTTTTGTAGACTGGATCCCACATTTTAGTCTGCCCTTGAG
TTCGGAAAATGAGAGGCAGGGGTCCCACTTTAGTCTGGCTCCTCTGGTCTCAGATCAAGCATACAAAAAACTGAAAGACTTACAAGAGTCTTGGCCCACC
AAGGCTAAAAACAACAAGAACAATCGAGTGAGAATTAGCTTTCCTCAACGTGACAATGCATTTGGGCCAGCGATAATATACGCTGTTTTGGCGACACGGT
TTCCTGAACGCCGGGTCTGGGAACATCTATCTCTATCTACCCCCGATTTCCACCTCGAGGAAGCTCCGCCTCCCTGTGAAAGATAACAAAATGAGTGAGA
AACAAGTACAGCCTATTTTTCCATGCCATCGAATTACGTACCAGGGGTTAATACGATTGTCGTCTGAGCCATCATCTTCGTCCCACGTAATACGTAGCGC
CTCCCACGGCAGCATTCCATGCTCATCAAACGGTAAGGACCCTGCAGTCACGCCTCCATAGTACTCCCCAGGCTGCCCTTGCGGGTTGCGAAACAGCATT
CGAAACTTCTCTCCGCATTGCCACGAGCGATTTACTGCCCAGGAATATCGGCTGATATCTACCACGTACTCGGGCAATCGATTCTCGAGGCGCAAGATCG
TCACAATGGAACGAGTTGGCAACTCTGCAGATACCTGCTTTTCAGCCTCGGGCTCGACTTGCTTGTCGAGAGCTTTCTCGGGGGACGACGTGCTTCCTCT
CTTGACTGGTGCCGACTCACCCGACGTTTCTTCACATGCTCGAATTTCCTTGCTCCACTTCTTTATTTGTCCATCCGCCACGTACACCAAGTTGTGGGCC
AACGGTGGCAGTGTTGGGAAACGACCTTCGCAAAAGAGCTGGCAGTTGTCCCGCGTAAGCCTCAGGTCAGTCATAAACTCCGCTGAACTGTTGTATTCCA
GGTTGCTGGCTTTCGCAGTCATTTTACCGAGATCCATGGGATGTAAGATGATTTCCTTGTACTGCGGGAACTCTCGATCGGATACAGGCTCCAGAAACGG
ACCGGCATCGGCCAGCATCTTCAGCTTTGCCAAAATTCGCAAAAATACTCGAGCGAGCCTCTGCTCTCGGGACGGAAGAGGGCACAGTAGGGCTTCGGGC
TCACGGGTGCATTCGTGCTGCGCCATATCCGGAATCGGCTGTAGCACAACCAATGCGTATGGGTCACCACCGCCATGGTGATAAGATACCTTCTCCACGG
TGCAGATTACTGTCGTGTTACGAATCGGAGTATCGCTTTTCTGTGTGAAACGCTTTCTCTTGGACTTTTCGTCTTCTTTCAACGCTAGCGAATGGCCATC
TCCGAAGTAGACAACAACCTTTCCAACCTCAGGAATAAAATTGCGAGTCTCCTTGGGTCGCAACTTGAGCCATTCCAGTCGGTCCAATCGAATGTGCAGA
TCCATAAAAGCTTCAACGTTGATAAACTCTTCAAGCAGCAAGTGCAGCAGAAACACGAGCTGGGCGTATGTGCAAGAACCCTCCAGTGCCAATCGCCACT
CGTGTCGTTTCCGCTGCCAGGAAGGGCGAATTGTTTCCACTCCTGAGCTCAAAGCTTCCACTGCCGCATTTTCTAGTTCCGCAAACAAGTTCAGTTGATC
TTTGAATGACTTTGCATCTTCCACACGAGAACTCCACGTCTGAGCACCTTCCCACGAAGCGGGCAACGTGTTCGTGTTATCAAGATGTTGTTTCAAGCAC
AGCAGCATCTTGCGAGCAATATCACATGACTTGATAACCGTATCTGCGTCTGTGATAGTCATAACCTCACTCTTGACAGCACCGCCAGGAAGAGGAAACA
TTTGAAGCTCAATGCCACTCTTTGCACTCCACACAATCTCTGTAGTGGCACCGTCCTGCTCGAAGCCGCTAAGCAACTTGTCCTTTAGTTCCTCCAACTT
TGTCAGCAAGTCCAGCTCTCGAACGCCTTTGGGGTTCAGCCACTCCAGGATTTTCGTAAGCTGGTCTTTATGGCCACAAACCACGAAGTCTCCGGAGTCT
GCACGCTCAATGAACAATCGTGGCTTCGTATCGTGCTTGAACATGTAAT