Description :
From Genome Similarity Track
Location :
Scaffold_418:16254- 17606
Transcript NameFunction/comments
Phymu_g9702sphingosine kinase, putative

Sequence
1352 bases(100 bases per row)
CGTTCGACGGCCAACTTCTTGACCTCTTGCTCGTAGTAATCCTTGCGtttttgaagctgcagcgtctcaGCTTTGTAGAATttgacttcttcttctaacT
CGTACAGTTTTTCTTCAATCACAGCAGGCAGAATCGTACTGGAATTTGTTGTTTGCGCTGTCTGCCGGCTTCGAGGTGCGTTGGACCCGGGTTTCTGCTT
CGCCGATGTGCGTGAAGACGAAACAGGCTTCATTTTTGCTGGACCTGTTCGCTTGCCATCAGCTTTCGGTTTATCTGCTGCGGTTTTAGAAGTGGGTGCC
TTTACCTTGACACGCAATTTCTGCTTAAGCGTGGATAAAGACTTGTCCTGCGcaggtggaggtggtgggGACGGCATGCTCCTGCTAAAACCTTTCGAAT
GCATGTCATCGTCCTCGCTCTGTCTAAACTCTCCAAAAACGTTCTGCACTAACGACGACACAGGagcgtcatcttcttgcACGCCATCCAAAACGCTGGG
CTTGCTGTATCCAAGTGCACCCGTAAGCTGGTCATTGTCTTCAAAGTATACCCCACGCTTGACACTCTGTTGTTCAGGGACCATGGTTGGACCAGCAGTA
AATGGATCATTTTGCTCGATCTTCGACTCGAGCGAGTCGCCAACGTTGGAGACCTCGCCACGAGTTGCGCTTTGCTGAGGCTGAAATGATAAGCCGTCGT
CCCACGGCACAGAATCATCAAAACTAACAGCACTCAAGTCCGAAAGTGGGTCGCCGTATCCGAAATGACCGCGAAGATGGTTTGTAAGTTCATCGCCCCC
GGCCATCCAATCATCCTTTGACAACGTAGAGTTATCGTCAAACACCAGAGCAGAatccgcttcttcgtctAAACTTTCGTCAAAAATCGACCCAGACGCG
GGTGTCTGCCACCGCGATCGTTCTTGTTCGTGAAGATCTGTTACGAACGACGAATACGGTAGGCGTATGTTGTCAGTCTGGTTGTCGTGGACCTGGTCTC
TTGTTGAAGGGCGATAtccttgctgttgctgcttctccactaAATAAGCTTCTTTCTCCGCAGCCAAATCCCTCTCAATCGCCTCAAACTCTGCCATTTC
ATTCGCTTCACGCTCTTGCTTTGCCTCATACGATTGCCTCACACTTTTCATGCCCATGAAGTCGGTGCTCGTTGTAGAACGAAACGATGCGTTTTTCCAC
TGTGCAGCATCCTCATTATGTTGTCTTCTCTGCGAAGTATCGACAATATCATCTTGATTACTGTATTGCCTCCGCCGAAATGGAGACACGGGTGGCGATA
GAGTCTCTGGAAGTACTGGAGCATCTCGTACTGGGGATGCGACTGGCGAAAT