Description :
From Genome Similarity Track
Location :
Scaffold_1628:1625- 3622
Sequence
1997 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCTGTTGTTGCTGCAGACACTCTGTATTGGGGATAAGTT
CGTTGAGGAGACACGCGATCGGCTGTTCCAGATGATCCTGGGGCGGTAGCAACCTTTGGGTCCTGCCGGTGATCGTCGGTGCCGGCCTCGATCAAGCGGA
GTAATAGGTTTCACGACGAAGTGTGAGCCGTTGATACTGGGATGGTGAAGTCTTGTCCGCAGTGAGCCGCCGTGCGGCCCGACTTACGGACAGGGGGCGC
TTGTGGTGAAGCACCGAACAAGAATTTCCAACTGCGATGACATCAAGCGACATGGTGGCAGAACGATAGGCAGGGATCAGGCTGCGGTCGCGGATCAAGA
GGGTCTATCGAGAGATCTCAAGCGATTGGATAACGTCGACGCGTAAGACAACACATATGTCAAGACAGATTACGGGCGATCGCGCTTGGACTGCGGCGTG
ATTCGACGTAGACCCAAGCCCGGATCGACGACCAATCTCGCAGATCTAGGGCGGCCGAGGACAAAAGAGGACGGGTCGGCAGCGCACGGCAACTCGCACA
GGTCATCGATCGGGAGTTGATCGCCGATCGCCGATCGCCGATCGATCGTGGATCAGGAGCCGATCGTGGATCGCCGATCGACCCAGATGGGAAGCACATG
GGGGCGAAGCCAGGGCAAGAATCCAGTGATCGTTTGGTTGTAGGATGGTAAGCAAGATGGTAGCAGTAGGGAGAGACCAGCTAAACATAAACGAGAAGGG
AATTTGCGCAGTACAACGCAAGTGGCCTGGAAACGTGGCGAGGAAGCACATATTGGCCTCGACCAGCGTACGTCGTGGGGAATCTAATTGGCCCCACCCG
TGATCCAAGACTGCCGAGTCCCTGCGATTCATTCTCGAGAAGAGAATTTGCACCAAATAGCACAGGTCCCCCAAGTCGTCAAGTCCCAGGAACTACATTG
GCCTCGGTAAGCATCGACACTTTTGGACAGTGAGCTAGTGGTACGGTTAAGACTGGATTAATACATTGGCCAGCTTGACCTACTCTAGTGATCCATCTCT
TGTGTGCAAGCCCTCGATCAACCGGGTACTGCTTGGCCGGCGATCGCTGCGTCTCTCAATCGACCTCGATCCCGCAATAGGAAGCGGCAAGCAACCCAGG
AAAGGAAGGAACACACCCGGAAAGGCAACTACAGGCCTTGGATCAACTCCAGGCCGACCGATCGGAGCGAACAACCCTCGATCGGAGCGTATACTCGGAC
GCAGAGCGAAGATTCCCGCGCTGCTCCACATCCTATCCCCGCGTCACGCCAAGACATTCGATCTTCACCAAGTGCTGCATCTTCGGAGCCCCGAGAGAGC
AGATCCAGCCCGCCGACGGGTACACAAGGTGAGAACAAGTTCGGCCGATCACGGATCGTTGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCTGGTGG
GAAGCTCGATCAGGCCTTAACCAGATTTTGGCCGATCCCGCTACACCACACAATGACCCGCCTAGTCGAGCAGAGATCACAGTGACGGCTGGTCAAGAAG
CGCCCAGTGCAGTAGATGAGTGTGGAAGTGAGCAATCCAGCGATTTGTCTGACTGGACGATCATCGACGACCCCGGGCCCAAGCTGCCGAGTCCGAGGCT
CGAAGATGAGATCGATGTGAGCGACGAGCCCATGTCGTCGGACCCGGAGGAAGACCTGCGCTTACGTTACCTTCTGGCAGCCAAGTACGAGGAAGAG