Description :
From Genome Similarity Track
Location :
Scaffold_141:162478- 164329
Transcript NameFunction/comments
Phyin_T30-4PITG_19993GMP synthase [glutamine-hydrolyzing]%2C putative

Sequence
1851 bases(100 bases per row)
TAAAATAGATTCTAATTACACACTGACCACTGATTGGCTGCACGTGGCTGGCTGGTGGAGGTACGTCATGATGTCAGCTTACTGGTTGTGAGCGGTCAGA
ACCGAACACGCCTAAGACTCGTCCGACCTCGTTCAACATGGCCGACGCCTCCCCCGTGATGAACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAG
TATAGCCACCTCATCGCGCGTCGTGTGCGTGAGTTGCATGTGTTCTGCGAGCTTTACTCGTGCCTGGTGAGTGCCGACGAGCTGCGTCAGCACCAGCTTA
CAGGTATTATCCTGTCAGGCGGCCCGCAGTCCGTCTTCGATGAGGGCGCGCCGCACGTACAACCGGAAGTGTGGCAACTTATCGAGGAGCAGAAGCTGCC
TGTGCTGGGTATTTGCTATGGTCTCCAGGAGCTGGCCTTCACCAACAACGGAAAAGTGGCGCCGTCGCAGAACCGCGAGTACGGCAAGGCCCTTGTCACC
CGCAAGAACGGCGCTGACTGCGGTGGTCTATTCGAGGGTCTTCCGGACGAGTTCCAGATGTGGATGAGCCACGGCGACAAGCTGCATCAGATCCCGGAAG
GATTCGTGGACATCGCCACCACCGAAAACTCGGAACACGCTGCCATCGTCAACGTGGCGCGCAAGTTTTATGGTATTCAGTTCCACCCGGAGGTGACCCA
CAGCCCGCGCGGCAAGGACATTCTGCGCAACTTCGTGGTCAACATCTGTAACTCGCCCACGGATTGGGACATGCGGAGCATCGCTGACGCCTTTATTGAA
GAGGTGCGCGAGACTGTCGGCCCTGAGGGACACGTCATCGGTGCCGTCAGTGGAGGCGTCGACTCCTCCGTCGCTGCCGTGCTGCTGCAGCGCGCTCTGG
GTGACCGTTTCCACGCTGTGCTCATCGACAACGGGCTCCTGCGCAAGGATGAAGCCACAGAGGTCGTCGACCGCCTTCAGTCGAAGTTAGGCATCAACCT
GAAGTGTATCGACGCCTCAGACCGCTTTCTGGCTGCTTTGAAGGGTGTTACCGAGCCTGAGTCGAAGCGTAAGACGATCGGCAACCTGTTTATTGAGCTG
TTCCAGGAGGAGGCTGAGCGCATCGGCCACCCCGTGGACTTCCTGCTGCAGGGAACTCTATACCCGGACGTGATTGAGAGCATCTCGTACAAGGGCCCAT
CGGCCACTATCAAGACCCACCACAACGTCGGTGGCCTGCCGGAGAAGATGCACCTGAAGCTCATTGAGCCGCTTCGTGAGCTGTTCAAGGACGAGGTTCG
AGAGCTCGGAATGGCTCTCGGCATCGACGAGCCCAGTGTGTGGCGTCACCCATTCCCGGGTCCTGGTCTTGCCATCCGTGTGCTCGGCGAGATAACGCCG
GAGGCTTTGAAGACGCTGCGCCACGCCGACTCGATCTTCATTGAGGAGCTGCGCAACAGTGGCCACTACAAGACCACGGGCCAGGCCTTCTGCGTGCTCC
TGCCGGTCAAGTCTGTGGGTGTCATGGGTGACGGCCGCACGTACGAGAAGGTAGTTGCTATCCGTGCTGTCAGCACTTCGGACTACATGACTGCCGACTG
GTACCACATGCCGTACGAGGTGCTCGGCCGCATGTCGAACCGCATCATCAACGAGGTGCGCGGTGTGAACCGCGTCGTCTACGATATCTCTTCCAAGCCG
CCTGCCACCATTGAGTGGGAGTAAGGTGAATAGATGGAGTCCTCGCCTTTGCTACAATTGCAGGATGGCTCCACACCTCTTGGCAGTAACATCAAGCTAA
TAATATTAGTGAACGGTTCATTCCTTAATGAACTACATGCATGTACACTAA