Description :
From Genome Similarity Track
Location :
scaffold_31:16247- 18348
Sequence
2101 bases(100 bases per row)
ACGACGAAGCTGCTCTTGACATTGTATCGCGTGCCTACCAGCTTTTGACTGTTGATAACTTCGATGCTGAGCCACGTTCAGATGAGGGACGTCGTCGTTT
GCGTTTCTTCGCCAACTCGCTCTTCATGGATATGCCAGAGGCAAAACCTATTCGCAAGATTCGTTCCCTGACGGTTTCGACGCCGTACTATAACGAAATC
GTTATGTACTCGATCAAGGATTTGACTGCTCAAAATGACGACTGCATTAAGTTGCTGTACTATCTGCAGACCATCTATCCGTTCGAGTGGGAGAACTTGC
TGGAACGCATTCAGGCGAAGGACATGAACGAAGCCTTGAAAAAGAACCCTGAGGAGGTCCAACTATGGGCTAGTTACCGTGGTCAGACTCTTGCACGTAC
CGTACGTGGTATGATGTACAACGAGGAAGCTATTCGCTTCCTTCACTGGCTGGAAATTGGGGAGAACGAACCAATGCACCAAGTTACTTGCTCGTGCAAC
AAGTGTTGCAAACTGAACGAAATGGTTGCGCTTAAGTTCAACTATGTGTGTACGTGCCAGATTTACGGTAAGCAAAAGGATGAGCAGAAGCAGCAAGCCC
AGGACATTGACTTCCTGATGCGCAAGCACCCGAATCTTCGTGTTGCTTACGTGGATGGTCCGAAGAAGGTGAAGGATGGCCCACCAAAATTCTTCTCGGT
TTTGATTCGTTCTCAGGACGATAAAATCGTCGAAATCTACCGTGTAGAGCTGCCGGGTAACCCGATTGTGGGTGAAGGTAAGCCCGAGAACCAGAACCAC
GCCATCATCTTCTCGCGTGGTGAGCTGCTCCAGTGTATCGATATGAACCAAGATGGCTACCTCGAGGAAGCCTTAAAGATGCCAAATCTGCTTTCTACAA
TGGATCGTGGTACTGAGAAGCGCCCCCTCACGATTATTGGTTTCCGTGAGCACGTGTTCACGGGTGGTGTGTCGAACCTGGCTAGCTTCATGTCGATTCA
GGAACTGTCGTTCGTATCACTCGGCCAGCGTATGCTTGCACTCTTCCATGTTCGTCAGCACTATGGTCATCCCGATATTTTCGATAAGCTGTTCGCGATG
AGCTCAGGCGGTACTGCTAAAGCATCTAAGGGCGTCAACCTGTCGGAAGATATTTTCGCTGGTTTTAACAGCACGCTTCGTGGTGGTCGTACGTCTCACG
AGGAGTTTATCCAAGTGGGCAAGGGTCGTGATGTCGGTATGCAGCAGCTGGCTTTGTTCGAAGCCAAACTGTCTTCTGGTGCAGGTGAGGCTGTCATTTC
TCGCGATGCGATGCGTATGGCCTCTCGTCTGGATTTCTTCCGTCTGCACTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACACAAACCATGACGGTT
GTGGGTGTGTACTTCTTCATCTACGGCAAGGTGTACATGGCTCTGAGTGGCATGGACAGTTACTTCCTTGAAAAGGGTGGACTGGGTATTGCCGGCACGC
TTAATACGTCGTGGGCATTCCAGTTTGGTTTCCTGTTGGTTGTTCCAGTTATCGCCGTTGTGGGTGTGGAGCAAGGTTTCCGACATGGTTTTACATACTT
GTTGTGGAACATCATGACGCTTGGTCCGATCTTCTTCACGTTCCAGATGGGTACGCGTATGCACTATTTCGACCGCACACTGATCCACGGTGGTGCCAAG
TACCGTGCTACGGGTCGTGGTTTCACGATTAAGCACGAGCGGTTTGCAGAGCTCTATCGCTTCTATGCGTTTAGCCACTTCTACCGTGCTGTTGCGTGGA
ATTACTTTTTCTGTTATTGATGTTCTACGCGTACGGCACGTTCTCGTGGTGCAACTGCTCTTGGCGGTTGGATGCCGATTACTACAACAATGTCGAACCG
ACGGACCTCGAGTGGCGGACTCGTTGCTACGATGACCACTACCAGTCTTGTGTTTTGCCGACCAACCAGAATTACGGTGTGATGTCGTACTCGCTGTGGA
TTATCGCAGCGACGTGGATGTGGGCTCCATTCTTTTTTAACCCAAGCGGTTTGGACTGGGATAAGATCATTGAGGATTACAACGACTGGCAGAACTGGCT
G