Description :
From Genome Similarity Track
Location :
contig_29:16241- 19047
Sequence
2806 bases(100 bases per row)
AGCTCCTCCCGGCACTCTGTCGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGACGGCGATCCATCTTCCGTCGACGACTCCATTCCTGGTTCTATCTT
GCTCTTGACATCCTCTTGAGTAGACTCACGGTGAAATCCCTGTGAGTTACCAGAAGATCCGGGCACGCGCACCATTGTGGTGGAGCGGGATCACGAAATT
GCTGACGCGATCGCAACTCACCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGCGGATCTTGACCTTACAGCTCACCTTGT
GTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGGTAATCACGCGAGGGAAGTCAGTGGTGAACAGGGCAGAACTGGGGCTTGAGGGCCCTTCAGGTATG
GGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGCAGCAGTCGGTTGGGTGTGATCGTGTGTGATCGATCACGGGGTGTGTCCTTTACGGGGTCCTTTT
CGATGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGGAGGGAGAAGGGGAGCGCACCTGGCCAAGCTATCCAGGGGCTTCCGCGTTCTCGCTTGAG
TCACTTCAGGTGGTTGTCCGGTCGTCGGGTAGGCCAATATACTTCCTTCCCCGGAATTCGGAAGACCACTTGCGTGCTACAAGGAAAATCTCTCTCTGTT
TATCCATTAAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGATTGCTGACATTCTTGGACCTCCGATGTGCCGGTATTTGTGGTACGTGC
TGATCTGATCGGCTGATTTGTACCCATGTCAAACTGATCGGTCGATCGGAACCCATGTTGATCCGATCGGTTGATCTGAACTCATGTACCCAACATGTGG
TACCGCGACCAAATCTGCCAAGATCGGAATGATGGTTTTCACATTCACCGTCCGGTCGTCCGACCGTTGATGCCGCCCATCCCAGGTCCAAAGCCATCCA
TCCGTACCCATCAACCAATCACCTGGTCGGACACGATCAATCCATCTCCAAAATCTTCTGGTCACTTCTCCACACACACTATCAATTCGAGGGACAACTT
CTACAGAATATCACAGGAATATGAAATGGGCAAACGCCAGCAAGCTAGGATACAAAATAGGTGGGTCAACCAAGGATGCCGGAGCGTCTCTGGTCACTAC
CTAACTGAACTTGATGTTATGAGGTGGAGATGCCACAGACGACCCGCCCTAAATGGTCGCAGCGTCCTTTGTTGTATCGCGGTTGTAGTCTCAGGTCCTC
TGGATTTCCGACGGTAGGCTTGGCCGAATTCACTTACGCAGTACTGGTAAAACAAACTCTGCTGTTGGCTGTAGACCTCTTCCTTCTAGATTTCGGCACT
GGGTGCTCTATCTTGGATTCACTATGTTTTGGTTAAAATATCTTTGCTTTAGTATGATCTGGGTACATTGTTTTCGCAACTTCGAAAGTGTCGACTCGAC
AGTTCTGCTAAATTATTGGTGGTAGTTCAAGTTGCGTTTTACTTGATGACGTACCACTGTCTTCGAACCCAGCAGTCAGTAGTCGATTGGATGCACATGA
CACCCTGACTCTTGGGGCTTCCAGCACACGATTTAGGTGTTGGTTGTAGACGATCTTGGTTCAGTATCTTTGGTAGTCACTCTAAACCACAGCAAGATGA
GGTGCAGTCTGGTATATGTTCCCAACTGTACTTTCCACCAGGATTTAGGCACTCGTCATAAGGGAAAGTCTGTTGGCTGGACAGAATGCGGGTTTGCAAT
CCTGGATTTGTACACATCCAGGATTCGCGCAGTCGTTTGGACGCATCTGCACTTAAGCGCAAGATCTTTCCATAAATCAGTTGCACCTCCTACGCCACCC
GTGTCGCACGGGTACAGCCGACCCACAGTCTCCAACTTGTCCAATAGTTTCCAGGCACAGCATTTTAGACCAGAGTCGTGACGGTATTGCGTCACAGGAA
ATCCTGGAGCACTCCGTGTCATCAGCAATTCTTTGTAAAGGAAACCAGCAAAGGTTTATTGTACCGTGGCTTGGTAGTACGTAACGCTGTTGATCCCTCC
CATAAGAGCCCATGTCGGCGTGAACACGCTCATGTGCATAAGGAAAAAACCTCTGGCTGCTGAGGGAAATCAAAAGCTGTCAATAGCCCATGCAAAATCG
AGGAGGACGTAGAAGTTGGAGTCTTGAAGATAAGCGAGAATGACTTCCAACATCGGCATTGGATATAACATTTGGAGAGTCTGAGTATTAGTTCCTCTCA
CGTCCACTGTCATAAAAAAAGATCCGTATCTTGCTTGTTTACAACGAGCGGAGAGGGACACGTCCAGTTCTACACCGCATAAAATTGCGATGTTGGGGTG
GGCATCGACATGCTTTGCACATCATCCGGCCTCAACACCACCTCGAGCGGGGGCATATCCTCCAGTGGATCGTTCATCCGAAACATGTCAACCTTATTCC
ACACCACTCTCCAATTTGTTTAGCTACTTAATACTCGCTCCCTTGACTTCAGCATATTTGATGTTGTCCAACAACAAGTCCCCAACTGCGCGCTGTTGAG
ACTGATTACATTACGCCGGACACTGGCACTAAATATTCCACCATGCCCGAGTCCCTAGTCCAGTGCTTGAGGGCTTAGAGACAGTCGCTGCCGATACGAA
ACTTGGGGTGCAAGCTCAGACAGAAGGGTTTGGGGTGATGTCGTTGTTATCACACAGGAGACCAACCTCAATATTTGTGTTGGTACCCCTGTAGGAAAGT
TACTTC