Description :
From Genome Similarity Track
Location :
Scaffold_1875:1624- 3181
Transcript NameFunction/comments
Phypl_g14309hypothetical protein

Sequence
1557 bases(100 bases per row)
CGACTTGAATAGCCATCCCAGGACCGAGTATCGCGTGTACACCCGGATCGTCTTCTCGGAGCATCCCGTGATCATTGTGTGATAAGTGTTGAGTACGCGG
AGCAGGGCGAGGACCTCCTTTTCCGCCGGGTGATATCTCAATTCAGCGTCTTGGAGAACACGTCCCACGAATCGTACGGGTAGCACGACACCATCATAGT
CTTGTCCCAAGACGGCGTTGATGGCCCACTTGTTCGCATGCAAGATGATGACATACTGCCTCTCGGGGTCCGGGTGCTGCAACAGCGGGGTCGACACCAG
ACgttccttcagcagcttgaacgaNCCGGGTGCTGTAACAACGGGGTCGACACCAGACgttccttcagcagcttgaacgcgTGTTTGGCCCTGTCGAGGT
CGCGCCCcgagcggagctgctcatcgGATAACTCGTACAGTACTGCCGCTATCACTGGTAGGtcctcgatgaacttgccgTAGTAATTGAGACTTCCCAG
GAAGGATTGTACCCCCTTTAGTGTCTTCAGGAACGGCAGGTCCAGGACTTTCGTGGCGAACTTGGGAGACGTGCGGATTCCATCCGAGCTGATATCATGA
CCGAGGTACTTGCAGTTCTTCACACCAAACTCGCTCTTCGGGAGGCTGACAGAGATGTTCCAGTATCGCAGACGGTATAACAGAGCATTCAGGATCTTGC
ACAAGTCGTCCCAGGCGGGGCTCCGTAGATAATGTCATCGATGTATGAACTCCGGAACAGGACAGGTCTCATCTGCTCCGAGGAAACCCGGTTCTGATGG
AAGACCGTATCCGTGCCGGTTCGAGAGATACCCGCCCCCCCGGGGCTCCGTCCCCTGGGATGCTTGGGCGTCGACATCTCGGTCTAGTCCCAGGAACTTC
AACACGTCGGgatccaccagcttctcttCGTCCGGTGAGAGCCGGACGAAACCCCAGAGACAATTGTCTAGGAGCTGCTGATAAATCAGCGGCGCATTCT
TCAGACCGAACGGCATACGCTTCCACTGAAANGACAGATGAAGGCCGATATCATCTTGGCTCGGGCAGTCATAGGGACCACCCAGAAACCACTTGCCATG
TCCAAAGTCATAAACCACATCGTTGCTGAGAAATTGctcacgagctcgtcgatcagcggcagcgggtAGTTCATCAGCTTGATCAGCTGATTCACCAGTC
GATAGTCGATGCACAAGCGGATATccttgccgttcttcttcatcacgatGACGATCGGCGATGCCCAGGCTGACTCCGAGTACTCGATCAAACCCGTTTC
CAGGagtcgcttgagcagctcgtagaCCTTGGGTAACAAATCCCCAGGGATCCGCCGGGTGCGTTGGGAGACCGGCTTTGAGCCGCCGACATCGAGGTCA
CAAACCACTCCTCCGGCAGGCGACGGCAAGGCGTTACCTTCACCGAGGAAGACCTTCTTGTGACACCGCAGGATGATGCGGAGAcgctcttcgtcctcgg
gGCCTGTCTTATCTGGGTCACCAACAACTGcttcgtcgatcttggcctcggATGTAG