Description :
From Genome Similarity Track
Location :
Scaffold_52:16237- 18117
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_52-fgenesh-gene-0.0Bromodomain containing protein
Pytar_ATCC12531maker-par_contig_52-snap-gene-0.14Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_52-snap-gene-0.15Conserved gene of unknown function

Sequence
1880 bases(100 bases per row)
CGGAACCGTTTTGGGAGCGCGTGAACTGGGAAGAGTGGGGTCTCTACGACTACCTCCAGGTCGTCAAGGTGCCCATGGACATGGGCACGATCCGCGCCAA
GATCGCCAAGAACGAGTACAAGAAGGCCGCCGAGTTTGCGCGCGACATGCGGCTCGTCTGGGACAACTGCAAGCTCTACAACCAGGACGGCTCGGAGCTC
TACCAGATCGCCGACGAGCTGTCCAAGAAGTTTGAGGACCGCGTCAAGTTCATGAAGCTCGACGTTGGTCCACGTCCTGATCGCAGCATCCCGTACGGAC
TGGATTTTTGACTGCGCAGAACATGATGGCTAGCTGATACTAACGCTGGGTTTTCATTCAGTGCGCCAAGCACGGAAGAGAAGATTGCGTTCAGCCAAAG
CATCTACAAGATTGCGAGCAAGGACCTGAGCACGATGGTCGAGATGCTGGACGACCAGTGCCCCAAGGCGCTCGACAAGGTACGAGTATCAAACAGCCTC
TGATACGAAGTAAAACAAAGAAGCTGACCTGGTGGCAACCATGGGTAGAGCTCACCGGATGAGCTAGACATCGTGATCGACAACATCGACACCAAGACGT
TCCGTGAGCTGGAGAAATTTCTCATGGAGAGAATCCCCGAGGGGGCGCGCGAGCCCGTGACTCCCAAGTCGTCCAAAAAGTCTTCGTCGAAGCGCTCGTC
GTCGTCGTCGACGTCGGGCTCGGCCAAGAAGAGCAAGCAGGCCGCCGAGTAGAAATGGACGCGAGACGATCCCTGTTCTCTCTCTCTCTCCCTCTCTCTC
TCTAACTCTATGCAAGCTGTGCTGTTGTTTTGGTAATCCAAAAGGCAATGCACGTGACGATGTTATATAACGGAGGCCTCAGGTCTTTTTCTTGCGCTTT
AGAGAACTCGCCAGCGTGGCCTGCCGTGCGAAGACTTCTTCAAACGACTTTTTCGCCTGGATCGAATGGTCCTTTAGTGGTGATTCGATCGCGTGGAGTC
GCGAGAGGTCGAGCTTTGGCACGTGACTGATTGCAACGGCCGGTTCCGGATACTGGATCTTTTGCTTGCTCCAGGGGTTGCTACTGTCGACGGTGACAGC
GTCCAGCCTCGCAGACTCTGATGATGCGAGTGATGGGGATGGCTTGTGGAGCGATCCCGCGGTGCGTCGTGTGGACTGCCACTGTGGTGGTACGACCCGA
GGAGACAAGTGCGTATCGTCTGTCGGAGGAAGTTGGAGAACCTGTGCCGCGCGAGTCGACTGCCTTCGCTCACGCTTGCCTCGCCCCGTGCCCGTCCCAC
TCGCCATGTTCCCCTTCAGCTGCAGCAGCTCGTCTTTGTGGAGCTCCATGAGCTCCTTGAGCGATGGCTGGTCGTCCGCTGGCGCCTGGGTCCACTTTTT
CCCATGCAGCTTCTTGCCCGCACGCATGATCTCGTCCCATTCCTTTGTGTCCACAACCTTTGTTAGCAGCTCATGGGATGTGATGTATCAGCGTGCGAAA
AGCTCCCGACCTCGTCGTGCTGACGCGCTGTCTCAACGCGAGCGGTCACGATGTCTTCGAGCTCATCATGGAGACGTAGCTGCTGTTCGCGAGCAGCGAG
CTGCGTTTGCAGTTTACCGATGAATCGATGCAAATCTTCTTTGCGCCGCTGAATCTGGCCCAGCACGCCGGTGGACTGCAGCTCCAGGGCGGCGTGGTAT
CCTGTTGGGGCAGAGAACGTTGAAAACTTATTGTTCCACCAACGCTCACACCCACACCCACGTACTCTTGCGATTTCGGCGTCGCAACTGTTGCTGAAAG
ATGGCCAACAGCACGACAAGAAGCAGTAATCCGCCGACGATCAGCAGCGGCGCCTCAATGTTCGCGTGCGCAACGCCTTG