Description :
From Genome Similarity Track
Location :
Scaffold_127:16232- 22445
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_127-fgenesh-gene-0.5Flagellar associated protein

Sequence
6213 bases(100 bases per row)
CTGCTCGACGGCGAGATCTCGCGGCGCGAAGCCACTGCGAAGGACGCGCTCGACCAGTTCCTGGGCAAACTGGTGGACGCATTCGACTTCCAGATCCAGG
AGCAGCAGCTCGTGTCCGCTCAGCAGCAACAGGTTAAGGTCAAGCACCAGAGTCAGCAACCTGAACTTCAAGCGTCGAGTGGCGATGCCTATGTCGCCAT
GGAGCTAGCAGCCCAGGATGAGGTGCTCTCGCCCCGCGCTCACCTCCCAGTCCCAGCGCCAACCAAACGCGCACTCCTGCTCAAGCGCCTGAGCGACAAG
CTCTCCGAGTTCGTCCTGAACGAGTCGATCGACCAGGCCGCCAAGGAGAACCCGATGGAGCTCGGCTGGGCCAGGTCGTCGCTGATCTCAGGGACAGTAC
CAGCGCAGCGCTCGTCCTGGCTCGACGACTTGATAGACCGCGTCACGGACCTGAGTCTCGATCAGGACGACGACGACGACGATCTGTACTTCCAGACCGA
CGACGAGTCTTCTTACTACGGCAGCTACGAGATGATGCCCAAGTCCAGCTCTACCGCAGTTCTCTTTTAAAAACCCACTCATATTCTCAATATAAGACAT
CTCTCAGCCAACCATACCCTCAGTACACATGCTCGCCCTCACGCGTGTCCTCGCCATCGTTCGGCGTCTCGTAGTCGTCAAAGCCCAGCACCTTGTCGGC
AAAGCCCAGCGCAGTGTACTGTGTGTCCATGACCACGGTCCCACCGTCGTCCGCCATGACGAGCGCATTTAGACAGCTCCGGAGCTCCTCGTCGCTCATG
GCCTCGCCCATGTGCAGCAGCCGCTTCTCCAGGACGTCCCAGCGCAGCGCCTTTGGCCGGGCCGCACCGCCCAGCACGGCAAAGGCGTGCTCGATCTGGG
CCTTGCCGATGCCAAAGACCGGCCGGTGGTTCACGTATAGCCGGATGAGGTCCTGGAGCCCGATGCTCTCGACAGCCGCGGTCGTCTCGACGAACCGCGA
GTACTTGACCTCAGCGCACATGTGCTGGATCTCCTGGTCCGTCGGGTAGAACCCGAGCGCGCGCATGACGTTGGGGATCTCGCGCAGCGGGATCTCGGCC
GTGATCTCGCGGCTCCCGGTCGCGTCCTCGCCCTGCACTCGCAACTGCGCAAGGTAGAAGTAGTCGACGATCTCGTGGTAGAACTCACCGTCCTTGCCGC
CCTCGAGCAACGCCACGTACGGTTCGATGCTGCTAGAGTCGCTGGTGGACGTGGCCTCGGCCAGGTCGAGCTGGTTCGTGTCAACGGCCCACATGTTGAC
GACCATGTCGCGGCCGCCGGCCGTGAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAGGCCACGGCAAGGTTGCTGATCT
CACCCGGGTGCGCGATAAGTCCCATGGTCTTGTGCGGGTTGCCGTCCAGCGGCAGCTTGAGCAGCCCCACGACCTTCTCGTGCGTGCTGTAAGCGCAGTA
GCGCTCAGCTTGAGACCCGTGAGGCTGGGACTTGACTGGGATCGGCACGAGCCGGTTGATGGGCCCGCCGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGCTCGCGTTCCATTGCTTGAGCTTGTAGTCGTCGTTGGCCACGACGAGGAGGTCCTC
CTGGAGCGCGCCGCGCGGGAGCTCCGGGTGCCAGCAACATGCCGTGGGCGTCGCGCCCTGCTCGATGCGCACAGGCGCCTGCGTGAGCACGATGCCGTCC
ACGATGCTCGAGCGGCTGAGACAGTACTCGACCATGATGCGGTCCTCGCCCACACTCACGAGCAGCGGCGTCCCGTCGCTCGCGCGTGAGAACTCGAGGC
CCGTGATCGGCTTCGAGTGCGCGCGGCAACGGCCAATGTACGTCCAGTCGTCCCCTGCGTCACCGCCGCTGGCGCGCCACATGCCCATGTGCAGACTCGC
GTCCACGGCCACGAAGAGCGCCGAGTCGGGGCTCACGCGAATATCCGTGATCGCGACCTTGGCGAGCCGGAACGTGGCCAGGTCGTCGAGTTGCTGCGCG
TGGAGGATCTTGACCACGCCGCTCATAAAGCCCACGAAGAGCTTCTTGCCGTCGGGCGCGAACGCGAGGCACTGCGGCTGAAGCTTGTCGGGCTCGAACT
TGCGCATCATCACGAGTCGCTTGGCGCTGTAGTCCCAGAGCTGGACGACCCCCGAGTACGAGCTGAGCGCGAGCTGCGCGTGCAGCGGGTGGGCCGCGAG
CCCGTGGATCGCGTTGTTGATGCCCTGCATGAGTAGCGTCCCGCGGCGCTTCTCCGGCTCGTGCTCAGCGAAGAGCATGGCGTTCATGCCCACGATGAAA
GCCGCGGACGTGCCCACGATGAAGTCGGGGACCTGGAAGAACTCGTCCTGCCCGTCCTCGTTGCCCTCGAGCTTGCCGCGGCGGCCCATGGTCTGCTGCG
GATCGATCGAACCACTTGAGGCGAACGACACAGACGTGACGGGCCCGGCGTTCATATCCTCGAACCAGGCCACGAGGCGGAAGTCAAAGTCGTAGAAGCG
CACGGCCCCGTCGCTCGAACCGAGGATGAGGTACCCATCCATGTCAGCGAGGTAGGTCAGCGCCACCTTGCGCTGGAGCTCCGAGCCGCCCGTGAGCCGC
ACGATCTTGACAGCCTTGCGATCCGGGAACCGACTGGTCCCCGAGCCCTTGGCGCTTGGGCCCGTGGCACGGAGGAGCGTGGACGAGTTGAGCTCGTCCT
CTTCGTCGCCGTGGACCGCGTCCCAGAGCACGAGGTCGCCGTCCTCGGTGCCCGTGAGCGCCTGCTTGGAGTCGGGCACGAAGAGCGACATGGTAAAGTC
GCCGACGACCTGGCGGAAATCCCGCTGCGAGAGCGACGGCGAGTAAAAGAGCAGCCGCTGCTCCTGCCAGTTCCAGAAGATGACGCGCTGCCGGCCGTTG
GTCACGATCTCGCGGATGTCGTACGTGTTGAAGCGCACGGCGTGCTGCACGTCCTCGGTGGCCACGAAGGACGAGTAGAGCGCCTTGGTCGAGGAGGAAG
CGGGTGCAGTCCACTCCCAGACCGAGAGCTCCTGGTGGAATCGCTTCTTCTTCGTACTTGGCTGGCCCGGGGGTTCCTGCGGCTCAACCGCGCTGAGCGT
GACGAGGAAGAGCGCGTCCGGGGACATGTCGAGGGCCTGGACGCCCAGCGGGTGCGGCTGGAAGATCGTCTTGATCGGGCTGCCCGTGGCTGTGTCCCAG
ACAACCACCATGGCCTCGTGGCCCTTGTCGGCCGTGACGATCCAGCGCTTGTCCTCGCTCACGACGCAGCAGCTGATCGGGTGGCAGTGGCCCTGCAGCA
GCGTCTGCGACCGCCGCGCGTAGTCGTAGACCACGCCCGTGTGCGCCGACGTGTAGAAGAGCGCGCGCCGCGTCGCACTCGATAGGTTGTGCACGCCGCC
CACGAGGTCCTTGTTGAAGCCAAAGGTCCACGCGAGGCGCAGCGCATTCGGGTTATTTGTTGAACCCTGGGGTCCTGGGAGACCTGGACCCGAGCTTGGG
GCTGGACCTGGGACTGGAGCTGGACCTGAGCTCTCTGCGGGGTCATCGTGCTGGTTTAAGTGCTGCTCCATCTGAGAGCTCAACAGGTGTGCTTATGAGG
CACCTCTCTGTCTCGTGGCGGTTTTGGAATGCATGTTGAGATTATTAAACTGCTGAGCTCTCTAAAGTTACGAGGCAGTGTGAGGTCGTTGGTAATTATT
TAAATATTATTATTATTTATCTATCGTGTCCAGGTAGGTGTGATAGAGCTCTTCAACAAATAAATGCTCGTGGGGACCTGGGGGATTTGGGGGACCTGAG
CGATTTTTGGCGACGACACACGCGCTCCCACTTGCGGCGCCGCACGTAAGAGGACGCGAGCTTCTCCGGGTACCACGGGCCGCTGAAGGTCGCCGCGTAG
AGCCACCCATCTCGATCGCCCTTGCCCACACTGAAGGTCCATCCCATGACGGCCTCATAGCCCAGCGGCGGCCTGGGCGCGACGTCTTCGAGCGACGCGG
ACGAAACGGCGCCGTCCTCCGTGCTGTAGCGACGCCGGTGGTTCACGAGGTATTTTTCGTTGGCGCTCCAGCCAGAGCCAAGCATCCAACACTCGTTCTC
GTAGACCTCGAGCGTCACTTGTGCCAGCTCGAGGGGCGTGACGGCGATGCGCAGGAAGACCTGGTTCGCAGCGCCAGTCTTGACTGAAGTGGGCGCCTCG
AGCGTGAACGCCATCGACTTGATTGGGCCATGGAGATCGTTCTCAGGCTCGACAAAGGCCCTGAGAGGCACGCTCACTGAGCCAATGAGGTCGTCGGCCG
TGAGCAGATCGTGGTCGAAGACCTCGACCAGCAGCGACTCGAGCTCTGGGTCGCGTACCTTGAAGTCAAAGTGCTCCGGAGGACTCCAGACTGGGTCCAG
CGTCTTGAGGCGACACGAGCTGCGCGCGCTGTGGCCGTCGGCCAGCGAGAAGCGCACGTACGGGTCGCTCGCGCCATTGTAGTCGGCGGCTTCGAGCTCC
TGGGCGTGCGTGAGCGTCACCTTGACTGCGTGCGTCGCCATGGCTTGAGCTCTTGGCTGGGGACGCACGAATTGGAGAATGGAGCTACAATGCTTGGGCA
ATGTATCGGCATAGAGAGGGAAACGAAAAAAGGTATCCATTATCAGATCGTGAGGGTGATTGATTGGCTACCACAGATTCCAACGACATTCGCGCAACCT
GCATGTCAATGTCGCTCGAAGGTTGCGCGAAGGTGGTTTGACTCATGACCACGCTTCTTGCATGTGTCATGGATGAGCTCATGGGTGAATTGATGCGTTG
GTTGGTGACGTGTTCTGTGGAGGGATCTGATTTTTTTTTCTCTACGTTACATACAACTACAGACAAGCGTACGTACGGCTGTGGTGCCTCATGCGGCAGG
TGTCTCAGCGCTAAACAGGACGACAGGCGCAGCCGCTGAACTGCATGCACGCCCGGCTCGTTCGCGGTCCGCTCTTGAGCTGCTCGCTCGCTCTGTGCTC
ATGGTGTCTCTACAACACCGCCTCGGTCTTGATCTTCTGCATCATGCGCTTCTGCTAGAACATGACCTGCGTATCTGCGCTCTCTGCGGTCGGCACGCAG
TGGTTCTCCCACTGCCGGCGGCGCACGAAGCTCAGGCGGCTCTTCGTCGCTGACCACGGGCCGAAGAACGTCGTCGCGTACAGCCAGCCGTGCGTGTCGC
CCTTCTTGACGCAGTACTCCCAGCCGCCGCCTGTCAGATGCGCGGGCACGGGCGGCGCGATGTCGCCAAAGTGCGCCGACGACTGGGCGTCGTCCTCGGA
GCTCCACTGCTGCCGGTCCTTGGTGTCGCACGCGCTCCAGCCCTTGCCCATGGCCCACGTCTCGTTCTCCCAGAGCGTAAGCGTCTTCTCGCCGTCGTCC
TGCGCGCGCAGGCAGATCTCGAGCTTGATCGTGCTGTGGCGGTTCTGCTTGGCGAACTCGGCCACGACGTCGAGGTTGAACACCTCGGTCACCGTCTGGC
CCATCATGTTGGTGAAGCGCGAGACCGGCACGACGAGCGCGGCGAGCAGGTCGTCCTTGTTGAGCGCGTCGTAGTCGAACACCTTGAGGCTCACGATCGC
GCGGCTCGCGTCCTCGATCTCGAACACGAACCGCTCGGCGGGGCTCCACTCCGGGTTGAGGTTGCTCTTGACGCACGCGCTCTTACGCTGCTGGTGCTCC
ACGTCCACGGTCACGTACGGGTCGCTCTTGCCGCCGGAGAAGCTGAAGTCGCTCGCGGGCAAGTCCGACGCGCGGTGCAGCGAGATCGTGAGCACAGGCA
TGGTAACTGCGTTTATGTGTGTGTGTGTGTGTAGATGAGGGTGCAGGGAGCGGGCTTGAGCGTGGCGCGGCGAGACTCGAAATGGGGCAATGGAGCTGCT
CGTGTGCGATATC