Description :
From Genome Similarity Track
Location :
Scaffold_29:162289- 176409
Transcript NameFunction/comments
Aphas_H257_10234dynein heavy chain

Sequence
14120 bases(100 bases per row)
TACTAATTGTCGTCCTGGAACAGCACGGCCACGCCCCGAAGCACCCACTTTTCCCGTCCGCAATCCGTTGGCAGCGTCGCGAGCAAGACGTACGTAGGTC
CTCGAAACCGAGTCAGGTACACTGGGCACTCGTACATGAGGGGGTCATGCCGGAGGTAGCCCACGCTCGTGGGTTCCCACAGGGGTTTGGTCTCGACGGC
CTTAACGTACACGACGGGCATCATCCACAGCAGCTCCTTCGGGTTGGAGTCCATGATTACCCCCCCGCACTCGGTCGTGGGGGACGCTCCGACCTTGTAT
CGGTTCGTGATCTCGTCCAGCGTTGACCACCGCGCCCCTTCGATGAACAGTCCGTACACAAACACTCCGTCGTCGGGGTAGTAATTGGCCGCTTCGACAC
CTGCAAATGTCGTCATGTGGGTTTCCACCGTCATCTTGTTCAGTGGCATCCTACAAAACACAGCAAACAACGTCAGACGACTATTTCCATAGAGAGAGAC
ACACACGTACATTTTCCGCCGAGACGTGACTTGTAAACAAGCTGTCGTGTACGCCGTGGGATTGAACAACCCTGGGAGCCACAGCGCAAACGGCGTGACA
AAATCCACAGACCACGTTTGCAGTTGCTGGTGCCGCTTGATCATGTCCACAAACCACCCGCTGAGTGTCTTCTTGGACGGCCACGCTTTTCGCTCCCACT
TGCACTGGGAAAACGGATTCCGGCCGGGCACTTCGTTCAGTCCGATCGCGGTTGCCAAATCCTCCATCGATTGACTCATGTTGAGCTGGCCATTGAGCCC
CTTCTTCAAATCGGCCAGCGATTTCCGCAGTTCGTCCAACAAGACGTTCATGCGATCGCATTCTTGCATGGCCACGACGACAAACGGTCCGTGGTCGGCG
GTTAGCCGCGGCGCGGCAATGTCCTGCAGGTCCAGCATCGAAAAGAACTCGGGGGTGCGGGCTTCAAAGTCATCGATCGATGCCTTCAGCATGGACGTCT
TATCCATGCCACCACCGCCACTGCCACCCCCGCCACCGCCAATCGACACGATCGCATAACACAACGTCTCGCACGTGGACGTGAGGTACCCGATTTCAGC
GTTCGGATGGAGCCCAAACAGCATCGGGTTTTCCGCGACCATGTTCTTTTCAATGTACTGCGCGTAATCTTGAAACGAAAACTCGGCGGGGTTGGGGCTT
TTGAATCCTGGCCCGAGCTCCATGCCAGACAGTAATCCCGGGTTTAACAACACTGTCAAGTACGTATTGTTCGTCCGGCGATCCCACGAGTCGGTGATGT
GGCCGCCGTACATGATTTCCCCGAAAATATACCGAAGGTCGTCCCATGGCACTTGGTCGTTGTTGTCCAAGTAACTCATGAGCACATTTCCGCAAATGGT
CAAGTCGCCCGTGTTGAAACTGTACGCACGACTCCATCCTTGCTGCCCAAATCGCCGGCGCCCCAACACAATCGCATGAAACCAGCACAGCGAAAACAAG
CACGCTTTAAACTCGGTGGGTTTGGTGCTGGCTTGGACCTTGTCGTCTCCGAACGTGGCCCACGCGCGGCGCAAGTTGGACTGGATGTCGGACGGCGCCT
CGTTAGCTACCTTGATGCACGACTGCATGAGCGACTCGGGTACATTGAGCTCCAACGGCAGCAGAATTGGCGGCGGCTCGGCGGAAATGAAGCACCGAAA
CATCTCATGTGGCCCTTCCCCCACGATTTCTTCCAGTTGTCGCTCCAGCTGCGGCAGCCAGCTCTGCATCAAATGCACGTTTTGCAAGATAATCCACCCG
CCCTTGATTGCGAGTTTCTTGAGGCAGTCGCCGGCATGCTGCTCCTGGCCTTGGCCCATGGAGATGTTGATAAAGTTGTCATTTTCGACACTCACGCCTT
TGGTTCGGCCGAGATTTTCTACCCACGGGGTCGGGTCCACCCCCGGAAACAGAACAAAGAAGATTGGAATTGCTGGGTTTGTCTCCTCAAACGTTTTCAC
CATGTCGAACGGGGGCTGGGACACGTATTGCTCGCCCAGTGACTCTAGAATGAACGTCCGCAACGCGTTCGTGACGCGATCGGGGCGCAATGCGCGCAGC
AAAATGATCTTGGAGAACGACGACAGTTTGCTGAAGTCGCCAGGCAACTTCGCGATTTCGGCGTCTTCGGCTGCAAACCACTTGCGCCACTCGTCCGGCT
CATTCTGCATGATATCCCCTAGGTTGTGGAACACTTTCATGGATTCCAGCGCCTTGAGCTTGGCGTAGCACGCCACGGGTAGCCACTCGGCCAACACCCC
CATGTTGCCCACGTCCGCCACCGCCTTGCCAAGCAAAAACGTTTCAATCTCCACGTCTGTCAGGACTTGGTCTCGCACGAGAATCTTCAGACACAACATC
GTGGCCACCGTGAGCTTGTCCCGCTCGAACAACCCCCGGCGAATGTAATCAAACACACACGTCGTGATGGAAATGATGAGCGCTACTCGAATAAACGAGA
TGAGCAACCAACAGAATGTGAAAAAGGCTGGACACACCTTTGCAACGGTTTGTAATGTCTTCGTCCGTGAGGTCGTTGGACGGGTCGTCGCTTGGGGGAG
GAGCCCCCCCTTCGGGGGCAGGGGCCTCTGCGGGCACTTCGCCGTCGGCGGGGGGAGCGTCGTCGACATCTTTGACCACGGGGAGGTTATAAATGCCTTG
CAAAAACACCTTTTGGAACGCCGCGAGCGAGTAAATGTAGTACGAATGCACTTTGGAGAGGTCGTTCATGAGGAAGAACAGCAGCGACCCCCGCGCGGCA
ATACTCCTGTATTTTTCGCTCGTCACATTGACGCTATCCTGCGTCTTCTTGGCCGCCTCCATGTTGGTCTGGGTCATCTGGGCCTTGTACTTAGTGTCGC
TGAGAATGGCAATCAACGGCTGGTTGCTCGTGATGTCGTCGTCCGCTTCGGCAAGGTACTGTAGAATGATATCCTCGAGTTTCTTGAGCTCGATCTTGCC
TTGGTTTTGCTGCTGGATGAGCTTTTCACGCTTGATGGCCAAGTCCGACCGCTCCTTGCTCACAACCAAGTTGAGCAGCTGGTCTTCGAGCCCCAAGTTA
GTCACGGTAAAGTTGACCATGGTACATTCAGCTTGAATTTCCGGCGGGTAGTGCGGATTCCCTAACTTGGTGTGCAAATACAGTCGGAACTCTTCGCAGT
ACGGCACGGATGCGTCCCCAATGACAATCTCCACGCGGTTGCCTCGCTTGGACGTGCTTCGTTGGATCACCGGCGCCAGAATCGCATCGATCTTTTCGCC
CAAGTTTTCAATCAAGAACGCCGTCTTGGTGCCAATTGCAGACTTGAGCTTTTCGATCCAGAATTTCTGGCCCATGCGCACGATCTGGAGGTTGAACGGC
GCTTCCTTTTCTCGAATCCACGCAATTGCTTGGAGTTGCGGGTCAATGATCAACGGCCGGCGCCCTACACCCAACATGTTAGTATAGATCCTTCAAGCCA
TACGATATGAAACAAAACTGCTAGAAATAATATCACAGAGAGCTCATTCTACGGACCCATGGCCACCGTGTTGACGACAATCGCGCCGTTCTCGGTAGAC
ACGCGATCGGCAGGCAGTTTCTGAGTGTTCCACTCTGCGATTTCGGCGTCGTTGGTCAAAATGTACACGGGGTTGCTCTCTTCACTCATGGCGATGCTGT
TGCCGTTGGCCGCTTTTCGAAGGTACGGCACCCAATGCTTGTTGATGAGTTCGTCGCGGAAGGGTTTCGTGAACGGGCCAATGTACGAGATAAACGCGGA
CGCAAGGAGACAGTCGCCGACAAGCAAATCCTTTTCCTTTTGAAGTTGCAACACGTTGATGCCCCATCGGACGTTCTCCGAGCCCAAGTCTTTGGTTAGA
GTCCCCGCCAGCTTCATCTTTCGATTGCCTTGCTCGACGGAATTCACCGCGTCTTCCTTTTCTTTCTCGGCGGCCGCGGCTTCCTCCATCAACTTGTCCA
GCTTTGACTGCAAGTCTGCATATATATACATATAGGCGTAAGTGTCGGAGTTCTGGGCTGTAAATACAAATGTCCAGAATCCACACAAACACAGACGTAC
CAGCCACTAACGACGTGACTTCACCCAGCCGTTTGTTGGCTGACTCGAGCTCCAAGTTGGCAGCTGCCAGCGCCATACTATAGCACATAACCAAGCCCTT
TCAATTCACTGTACAACCTGAGATAAGCTTGATCGAATATATCGTTACCGTTTGGGTTCGACCGTGATCAAGATATCATAATACATGACGATGTTGACCA
CCCAACTGCACAACCCGGCGGCGGCCTTGTTCTTGGTGGCAATGATGTCAGGTTTAAAGTGCTCCTTCTCAAGGAACTCGCGCACTTCTTTCCAATTCGT
GGTCGGGACTTGGCCGGCGTCGACAATATCCTTGAACTTTTGCAGGTACTCTATGTACTCTGGGATGTTCCCCAGCACTTGCTTCTTGCACGCGTCCCAC
TTGAAGTCTTTGACTTTGCCTTGCTTCGTGATGACAATGTTGGGGTGGACGCCAGCTAGGAGCACCATTGTTGCCCCAAACACGTCGTCGACGCCCGTCG
GCGGCTTGCTCATGGTTTTACACTCGCCCAGATCCTTCTTGTTGAGCGAGTCTAGCGCCTCCATGGCCTGCTGCACGGCGGGCTCGGCTTTGGCCAAGTC
TTCCAGCGTCGATCGCTGCTTCTCGGTGACTTCGGCTTGAATCACAGCGCACTTGGCAGCCTCCTCGGACGCCTTCTTGGACTCGACCTCGACCTTGGCT
TTTTCTTTGTTGACCGTTTCGGCGATGCCCGACGCGACCGCCTTTTTGTCTTCAGCTTGCTCCAACTTGACCTTGAGTTCGACTTCAAGGCGGGCGACGG
TATCCCCCGTGTCTTTGAGTTTCTGGAGCCCCTTCTCCAAGCGCTCGATCGCCCCCGCGTACTCTTTGACCTTTTTCTTGAGAATGTTCTTGTACAATTG
CAGCAACTCCAGGTACGATTTGGGCGTCGTGTACACATACCTACAACAAGACGACGACCCAACGACATCATGAATCGTTGCTCTAGAACGACTGGGGCAA
GTATATAGACATACCGTCGTTCGACTTGAAAAAACCGCTCGGCGCATTGGTTCACAGACACAAACGAGAACGGCATAAAGTTTTCAATGCCAGTTCGCGA
GTCGTCCGATCCAAGGAGGTCGCTGATCTCTTTGAGCTTTTCCTTGCCCACCGACAACAGCGCTTCCTTTGGCCACGGTTGGAACCAGTCGATGACGGTG
CAGTTCACTAGCGCTGGAAACTTGCGCGCACGACTTCGAAAGTCGTCCCCCACAGGGCTAAAGCACAGACACAAATGCAACCGTTTACGAATCTCGCCTT
GGAAGAACTTGATGATTTCCTTCCGGTCCTTGGACCCGGCCATGACGCACACCTATCCAGCAACTTGCTTAGCCACGGCCGACTTCAAACTATGTACGGT
AGGTACCATGTTGACAATGTTGTCCATGTCCTCCATCGCAAACAAGTCGGGAATGTCCCCCGACGCCAGCAAGTCGTTGAGGTAAATCAGAAACTTTTCG
TTGGTGATCTGCGAGTCGGTGAGCAAAAAGACCACGCCGCCCTTGTCTTCGCTACGACTCAACTGGTCCACAATCACAAAGTACATCTTGCGCAAGTCTT
CCTTGAACTCGTTTTCGCCATATTTCGACGAAATCGAAATCTGCTTGACCGTGTATTCGCAAATGTGCGACGCCAGCCGCGCCAGCGACCGCTTCCCCGA
CCCGCCCACACCCACGAGCAACGCGTGCCTATGCCACCCACGTTGTGCAGCAACTACTACACGAATAAACTAGTATGTTCGTACCCGGATTCATTGCGCA
AGATGCGCACGATTCGCGCCACGTGCTTGATGGCGTCGTCAAACAAGTCTAGAAACATGGCCGTGTTGTTTTCGTTGTTGTTAAAGTCGCGGAGTTGGAT
TTCCAGGTTCTTTTTCAGGTCTTCGAGATTTGTGCCCATTACTTGGTCGTACTCGGGGTCGCCGTCCTTGGTAAAGTGGCAAAATATGAGAGGCCACGCG
TTCTCGAGCGCGTAGTACCGCGACGTATTGCAGGTAGGAAAGCTCCGTTTGACTTGGAGTTGCACCAGTTGGTTGTACTTTTCAATGTCGGCTTTGCACA
CGAGGCGGTCGCCGTACACACGCTCGCTTTCGTGGAGCCACAGCAGCACAAACTTTTCCGCGCTCGAGAACCGATCTTTTTTGGATGCGATCAACCCCTG
AAACACATTCGACAAGTGCCGGACGTTGAATTCGTAGTGAAAGTTGGCTGCTGTCTTGCGAAACGTTTGCACCACCGACGTATGCAATGTCAAGGCGGCT
TTGATGAGCGAGTTCCAGAACGCCGATGCACTCAACTCGCCCGAGAATGTGCTCAAGTGACCGCCCAGGAACGTTTCGTAGATGGTCACTAGCGACGGCG
CTTCGGGCATCCCCATCGCAAATGTGGTAAAGTGGCGCTGGAGGCGTGGGTCCACTAGAAATGACCCCGCTGTGGGGTTCATACCCGCGACAATTTGCGT
GTTGAGGATGTTTTGGACTTGCAGCTTCGCCCGGTCAAACCTACAATTCATATCGACTTGTCATGCTAGACACATGACAGCAACACGAGTGGGGGGGGGC
GTGTACCAGTGCTTGTATTCCATTTGCTGGCGAAGCAACGAGATGGCCGACTGAGTGTTGTACGGGTCCACTTCTGGAAGATTCAAATCGTCCAAAAAGT
AGATCAGACGGTACTTGCCGGGGGGGCCAAAGTTGGACCCAGTTTTCTTTTCCAAGTGCGAAAACATGGTCGACTGGAGGATCGTGGAGGTTGTGTAAAA
GTTGAAGTTGATCGTCGCGTAGCGAAAGATGGACGTGCCGTCTTCTTTCGACAACTTCTTGAGCACCCCGTTCACGTTTTGCGTCTTCCCAGTGCCTGCG
GGCCCACACACCAGAATCGGGTGCGATTTGTTGATCAAGTTCTCGAGCCAAAAGCTGATCGAACACGTTTCAGTGGTCGGCACCTACGCATAGACCATTG
ATATGAGCCCCCCATACCCCCCCAAGATATTCCATCGAAACAACAGCCCCCCGTCCAACACCCCAACGGCCCCCTGCAACCCCCATAGAAATAAAGCATG
ATGGAAATATACCGTGATCTGGTTGATCGGGTCAGGGCTCTTGTACGTGGCCGTGTAAAAGTATGGCGACTTGCTCCACGGGTTAAACTTGGACGTTTCT
GGGTCGAGCCAAAAGTCAAATACAGTGTTGTTGGCACTCGCAACGATCTTGACGTCTTTCCATGTGGTTTTCCACCACGTGCTAAACTCAGCGGCGTAGT
CGGTGCCGTCGTCGCTGATTGTAAGGATCGACCCAAACGACCACACGCAGCAAAAGCAAAAGTTGTTTTGCATGACGTCGTAGTCGGCCAGAATCGTGGG
CGTCAGCAGGCAGTCGAGCATGTTCAAGAGGTTGCCAATCAGTGTCACTTCCTCGACGGGGATCACGGGCTGCAGCCGCTTTTTGAAAAACTTGAGCGTG
GGCTCGCAGTACTGGTTGAACAACCCCTGAAAGTTGTCGCGCACTTCGTTCGTAAACAGCATCGTTTGCTGGTTGGCTTTCTTGGTCGGGTCTGGCGTGC
AGTGTCGCAGCAGCCACGAGTCGATCAGACACCGCCACTGGTACCCTTCCGTCGCGGAAATGTACAGAATCCCCGCGCGGGACACGGTCGCTGGTGTCGC
GTACACCAAGTCTCGGATTTCAAATATCATGCGCATGTGCGATTTCAACGGCACGCGCTCGTTGGAGGCCAGCGTGAGCATTCGGTTGTCGTCCATGACG
GAGTTCATCGATTCGATCCAGTTGGCATCCAGGTCGCCGTCCAGCAGAATCCACTTGGGGGACGTGTCGTCTTCGCCGTTGTCTTTGGTGCGGGACCCCA
AGTCGCGCATGATTTTACTCAGCAACCCGTCCTTCCATTCGCGGGTCTTGAGCACGATATACCCGTACAGTTCGTTGGTCGAGACCGACTTGGGGTTCAA
GTCTTGCACTTCCATGGAAATTCCCATGATTTCCCTGGCCTTTCGAAGCGTCTTCCACGTCTCTGTCTTGCCCGACGCCGGCGGTCCCATCACAAACACG
CAATGGCGAATCGCCAGCAGTTCCGACAATTGCACCACCTTGAGCATGAATTCTTCGCGAGGACTACAATGATAATCATGTAAATATTATGCAATTTGGT
TGGAAATATCTATCCAACGACGTTGTTTCCAGGCAAGTATATATATATGTATATTCCAATGTTGTTCATTCAAAACTGGAGCGGTATGCCGATGCACAAG
ACAAATAGCACATGAATAGGCAGATAGCTTTTGAAGACACGAATCAACATCTCAACCAAAATCTCAAGGGGCCTATCCCAACTGAATAATTCCCTATACA
CAACACGAGCCACTACAAATTGATAGATGATATATATTTGGACAAACACAAGTCTAGATTTAAATCAAAAGAAAATGTACCTGTTGTTGATGGCTTCACA
TGCCCCTTGCACCATCGACTCGAGTTCTTGGTCGCGCTTTCGGGGGGGGTCATTCCGGACGTCAATGTTGGGGTCGTTTCTCGGAAATAAGTCCCCCAGC
AGCCCAAAAAAGATGACGTTATCCTCGACGACAATCTTGGGGATGTTGAAGTCACGCAGCGCGCGCATGAGAAGATCGGGTTCGGGGATGTCTGGCTCGG
CGCGCTTGAATGCCCCCGCAACACACAAGACCGACTTGACTGCGCGGAGCCCCCAATCGTAGTGTAACTGCTTCGACAGCAACTGGCCGAGCAACGAGTA
CAACCCGTAGAATTTCGACGCAAGGATCTTGGCTTGCGTGAACCCTTCGGCCATGAGCATGTTTTCACAAATGAGCACCAGGTCCGGCACCATGACCGTC
ATGGGGCGGAAGAGGGCTTTGAGCCCCTCGGGCAGTTCCGACCGGCCAAGGTACCCCGGGTTCATCGTGATGAATGCCCCCACGGTGGGGTCGAGCATCA
CTGGTTCGTTTTCGAGAATGAACCGCTCGTCATCTGCCTTGCATGCGTCGCACACAGCTTTGAACTGGACAGAGCACACCGAGAGCACTTCGGGGACAAG
CCGGTTGAATTCGTCAAAGCATCCCCACGACCCAGACGATGCCAGTCCCTTGAAGATGTTGCCCAGTGATTTGTAGTCCATTTCCGGCGAACAATTGAAC
ACATAACAGGCTTTCCCGAGTGCATTCGCCAAATCTTTGGTAGTTTCGGTCTTGCCAGTCCCAGCAGGTCCCGCGGGCGCGCAGCCCATCTTCAAATTCA
ACGCTTGGGTGGCAGTCACGTAGATACGATCCGTGAGGGGCGTGATCACCAGACGCGGTCCGTTCCCAAGGTACTCGTAGTCGTACGGAATGCCGGCATC
GCAAATGAGAATCTGTGCCCGCGAATTGTTGGCCCCTCGAAAGTTCTGGTCGCGGTTCAAAAAGCTACCTTGGGTCGGGCTAAAGTAGTGTTTGAGCTGC
GACTGCCACATGAAATGCGACGCCACGTCGACGCCCGCACGGACCATGTTGGCCACAATGTCTCGACCGTGGGCGTCCATCGTGATGAGGCACATGACGC
GCTGTCGTTCGGCGTTGGAGATCTTGCTTTGCGTGAGCTTGATCAAGTCTTCGAGCTGAATCTCCTGCTTCTTGTTGTACCGCATCAGCGACTCCTTGTC
CCCCCCGGCCATGGCGGCAAACGACGCCTCGACTTCGGCCACGTAGTGCACGCCCGCGGCCAGTAGAATGATCTGGGCCGCGTCCATCGGCTTGCCGCTC
GCGTCCTGGTGGTTGATCCACTCAACCCGCGGTTCTTGGGTGTACAGCACCAGGCTGCGCTCAATGTGTTTGAACAGCGTAAACTTCATGGCTTTCAGGA
GGGCCTCGAGGTAGATTTCCGCCTCGCCTTCCAGCAGCACTGGCTCAACAAAGTCGACCACTTCTTGCCCCACCCCCGACACGAACGCCGACGCGGTGGG
GCGCCCCCCCGGGTTTGTCACTAGGGACATGGTCTTGCATGCCAAGTAGATTTTCGACGCATGGGGCATGATCTTGGCCGGATTGGACCCGTTCGACAAG
ATGTCGAGCAAATCGGCTTCCGACATGAAGTAAAAGCGGGGAAACTGGCGGCGGCGGCCGTCGAGAAACTCCTTGAGTCGATGTTTGCACAACTCTAGCT
TTTCCACAATGCCTTCGAGGAACTTGAACAGGCCCGGCTTTGTGCACGCCTTCTTGACGTTCTTGGTGATCCACGCCTCGCGCAAGTTCTTGCGCACTTC
GACGTCAATGTCCTCAAAGTCTGCCGTTAACGCCGGCAGTTGGTTTTTCACTTCTTCCGACTGGATGAACAGCGGTTCCAGGTAACTCCAGCTGCGCTGG
ATTTCGCCAAATATGACCACCACTTCGTTCACACTGGCCAGTCCTTCGTGCATTTCCGTCACGCGGCCTTCAAATTCTGACTGGTACGGCGACGACGTCA
TGGTCTGGACGTCGATCTGGTTGGTTTCGAGCAGCTCAAAGTTGTCTTCAGAGATTTTCAGCAGCGGCACTTGGTCGTCTTCGGGGGCGGTCGGGTTGTA
CGGCACCATTTCCCACTCGACTTGGGCCCAGATTTCCTCGAGTTCGACCAGTTTCGTTTCCAGTTCCTGCTCCTTTTCCGCTTCGTAGCAGATTTCACCA
ATCTCGCCGGCGTATTCATGCAGCCGCTTGCTCAACAAGAAGCCCAACTTTTGGTCGGGGTTAACGTCCGGGGGCGTAAACTCCCCCGTTAGCGCTTGGA
TCCGTTTCCAGTGGCGAGACCGCATGTACAGCGAGCTCAAGCACCGCAGCAACGGATGCGTCTTGTCAAATGCTTGGCACTCCTTGAGAATCCACTTGTA
CGCGTCGCACCTAACTCAGAGCTGTCAGTTGGAGTTGCTTTGACAGCAATTTCAATGGATTATTCTTCGTAATAATCACCGACCATTGAATTTCTTTGGG
AATTTTCTTGAGTTCTTTCAACGTGGCCGAAATTTCCATGGCCAACGCGTTGCAATCAATTGACAGCCACGGAATTTCGTGCGTCGCGACGAAGAACGCC
TTGGTGCGCTTGATGATGGCCCACACGGTTTTCGATCCTACAAAGATGTATAAAGATATTTATAAATATATATTTGATAGAATATATAAATATATTTTCG
ATGTATCTTATATGTATTATGATGTATATATTTATATATATTCATTCAACTATTCCCATGGAAGAAAAATACCCCGTTTGTCAGGTAGATAGATATTCAA
TCAATCATCTCGCACAGAAAAATATAGGATTGGTTGGTTCAAGAACGTACCTTCAATGTCGGTGCGGAGCGCCGTCATCATCTTGTGCGTGTCAGTCATG
AGGTGGGGGAACCCAAAGATGAGGCTCAAGTCGCTCTTCTCGGCGCATCGTTTCTTTTCGTTATCCCATTCGACCAGTTGCATTTCAATCTTCTCGAGCG
CCTTATCCGGTTCGAGCTTGGAGTCCCAAAAGTCGAGCGTTTTGATCGTGTCGCCCCATTTTTTGATCTTCTTCTCGTACTCGACGATCGTGGCCTCGGT
CTTTTCCGAGAACACACGCGTGGGCTCTGTGATCCGCGCCTCCGTATCGGGGCATTGCACTTGGACATCGTGGAACAACTTGGCCAGATTCTCCACGTCC
ACTGTCTCCTTGTCCACGTGGGCGCCGATCTTCTTCATGTAATGAAACAAGTTGGACGTTTGCTCTTGTAACAATTGGTTGGCCGCACGGTCGTTGTCTA
GCTTGCGCATCAGGTCTTTGATCTTCTTGAGCGCTTCCAACCCGTCCACGTCGTTGCTGGGAATGTCCGCCTACACCAAAGCCATATATATATGTATATA
TACTTGAGATGATAAACAATGAACAGTGTTGTGTGTTGTACCTTGAGTTCTTTTAGCACGCGCTTGAAATCGCCCGCACGTTTGGTCGTGTCTGTATATA
GCTTTCGAATCAAATCGCTCGAGTTGAAGTCATCTTCCCGAGCAATCGACGGCACACATCGGATTGTCATTTCGTCGCTGGGTGGCTGGAACGTACACGC
GAACGGTGACCCGCGAATGGGTCCGGCAATACCGTCAAATGTCCCTTCGAACGTGATTGTGAGGATAAACTTGCCCGCGGCGGGGGGGACGAACGTGACG
ATGTAGCGCCCATCGCCCTTGTCGTTGATGGTCGAAATATCCATCTGGATGCCGCCATCTGGGGCGTCGGTCACTTCGGTCAACCGGATGGTAAACACGT
CCCCGCCACAGTCTCGCTGGACGCCTTCCTTGTCCACCGCTTGAATCACAAACGACGTGGGTTCTTGCGCCATGACCAAATGCGCCAGTGACAACATCAA
GCACGGCCCAAACCCGAGACTCTTGGACGCATTCGTGACGCTATGAAACTGCGCGACTTGTGATATATATCATTGTTCACTTTGTGATATATATATTACT
TTTCATTGTGATATATATCATTCTGCATCGTTGAAACGATTGGGTGAGAAAGTGCACATGATATACCTTGTACGACGTGCTGATATTGGTAAACGATTCT
CCTGGAAGCGCCACGCGCACCTCCGTTTGCAGCGGTCCATATTTGTCAAAGTTTGGCGTGGTGACTTGAATCGTGGTGGGAGATAACACTTGCCCCTGCA
CGTCCAGGTACCCTTTGGAGACTGCGAATCGGACATTCGCCGACCCCCCCGTAAAGTTGTACCCTTCGACTTTGACTTTGGTGCTGCCTGTGATCGGCCC
CGACGCTGGCACGATCGACGACACCGAGTACGGGGGACCCACAATTTCGCTCACGTGAAGACAATGCAAGTCGCCAAACCATCGGTTGGCCCACCCCCCA
AACAACAGCACTTTGTAGCTCACGGGGTCGTACACTAATGCCGTGTCGGCTCGGGGAAGGGGCGAGTCCCCTTTTAAAGGCGGCTGGCGCCATTCCATCA
ACCCCGTGTCGAGAACTGACACATTGTTCAAGTACGTTCCCTGTCGAAATCAGTTAGTAAAGTCAAACCACAAACATTTACTTGGGAATTGCCCGATTCG
TTCAAGTCGCCTGAATTGCCGCCAAACATAAAGATCTTCCAGTTCGGCACGGCTTGCACTCTACAGAGTGGATATGTATGACATCATTGTGCGAACATCA
TCCGATCATTTTCAGCAGGTTTGTCGTACCCGACACACGAATGATTCCACGTTGGCACGGGTAACTTGGCGTCAGGTGCACTCCATGTATTCGTGGTCAA
GTCCAGAACAAACAAGTCTTGGAATTGCTTGACCGAGTTCCACCCGCCAATCACAAACAGCTTGTTCAGTATCAAGCATGTTTGGTGGCTCGATCGCGCT
TCGGGCTTTTCGCCTTCGGTGAGAATTTCTTCCCATTTCCACGTGCGCAGGTCCAGCGCATGGACGTCGTTGAAGTCAGTGCGGCCGTAGCCGTTGCCTC
CGTAGCCCCCAAAGATGTACATCTTGTGGTCGACCAACGTAGCTGAGTGCGATCCACGGCATTGGGGCAAACCTTCCCAAAAGTTCTGGGGGTGTTGCTG
CTCCCACAATTTTGTGTCACAGTCAAATACCCACAGGTCGTTCATGCGTTTTTCCGCGGCGAACCCGCCAAAGATGATGAGTTTCTTGTCGCTGTACAAC
AGCGCCGAATGGCGCCAACGGGCTGGGGGGGTGTCTTCTGGGGCAGACGATACTGGAACGATGCGAGCCCAGTTGAATCCGCCGTTCATTTCTAGCTTGA
GGAGGTCGTTGCTTGGCCCGGGGGGGATCTTGTGGTCGCATCCTGCAGCAAGAATGAACCAGCTACACTAAAGACAATAAAATTGTACCCCCAAAGAGGT
AGAGCGCGTTCTCCGACCCTCGCAGAGTCAGCGTATGCCCTGACCGTTTGTTGGGCACTTCGCCAGAGCACTTGGGGCTAGCCCAAGACATTTCTGGCTC
GGCACCATACCCGATCGGCT