Description :
From Genome Similarity Track
Location :
Scaffold_14:162253- 167992
Sequence
5739 bases(100 bases per row)
ACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGG
CGCCCATGGAAAGCCTCACCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTG
TAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGAAGCAACGCGATGTTGCTGCTACTACTGCGGT
GCCGTCCGGGACGGCATCACGCGCGCAATCGCTGAAGCTCGATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTC
GACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAGGGTTTGGTTCGCCATGTCATGTTTTGGCGGACGTGCAAGAAGTTGGGCGTGTGGAC
GCCGACTCTCGGATCCTACGTGTTTTAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGC
GGCACGGTACTTGGTCTCGAATATCGTGACCAACCCGATCGACGAGGCGACCAAAGTCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACC
TAACCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTACAACTGCTCGACCCCAGCAGTCGCAGGGAAACAATGTGCGAT
GCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGACCCCCGTGCACCAGCAGGGTGACTATCGCGGCGGTGACGGGCACCGTCGCAATCA
AACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAACGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCA
GTGAGGTTCATTCTCACTGCAAGAACCAAGATGATAAGCCTGACCTTGTCATCCTGAATGTGAATTCGATGAGAGCAAGCGGCTCTCTTTGTGCTTTGGT
AGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAGGTATGCTAGAAGTACGACTG
GCGACGGGCGTCGTCGTGAAGACCGAGAAGCGCGTGGTACGCGTGCGCTTCATGTATGGAGATCGAGAGTTTGTCGAGACCTTTATCGCCTGGATCTGGA
CGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGTACTCTCGTGCGCTTTGGTCGCGACAGC
GGAACAGTGAGCGATGGCCCTGTTGCCGCTACACACGCACCGACAGGTGCGCGCGACCCCCCACTCGAGACAGCGCCTAACGCCGCTGTCCCGGAGCGCC
CTGGGCGCGCGCGAGCTCGCGCGCAAGAGCAGCTAGTGTCGGCGTTGCCGCCGACAGCTAATGACGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTT
TTCAGTGAATTAGGAAGAGTCTCCGGCCCCAAAGGGCACGGATGACGCAGGCGAGTCACACAGCTCGGCCGTGGAGGCTGACGCGAATCTGATTTGATCA
GATCTGGCCAATAATAAGAGCCAAAGTGACGTAGCGCCGTCAACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCCGGGAGCCGGCGCAC
CCTCCGTAACGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTATTAAAGTCGCGACGGTTCCGGGAACCGGCGCTGCGAAAAGAAATTTCGCGTCGACTCC
GGGAGTCGACGCACCCCTTGTAATAAAGGGCTCCGCCAATAACAGGCGTCGAGGTAATAATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCG
GACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGATGAAGCGCTGTGCGACCAAGCCTGGCTTGAAGTCGCTC
GCCCGCGGGATGTACCCGCCGGCGGTATAAAAGAAGAACACCCGTCTACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAAC
AAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAATCTCGGCCTGGGGCCGAGATGCTACAAGAAATGTCTGCCGGTCAGACGGAGGCAGAGAAACCGGAC
GTCGAGACGTTGAACGTCTTGACGCGTACCTGTACCGGGTTCCAGTACAGGGAGATGACTCTCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTTGC
TTCCAGTCCATGACTGGAAGCGCTTCGCGCGTGACTTGCACGATGGATGCATCGAGCAAATATGCATTCTCTCGGACTCCGAGAGAACGAAGAGCGAGAA
TGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGACGAACAGAGCTGGGAC
TCGTCTTCAACGAGTCCCTATTACAAGATCATACGGGAGTACGCGGACGTGCTTCCGAAAGAGATCCCTGCGGTGCTTCCGCAGGGCAAGGGCATCCCGC
ACGAGATTGATCTCGTGCCGGGAACAAGGTACTGTGTCACGCGGCAGTGACCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTATTTGAGAGTCG
TCGCAAAGCTGGACAAGTGCGAGAATCGAAGTCCCCGCACAGTGCTCCGATGTTCTGTGTCGAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTAC
AACAAGTTGCACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTTATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTG
ATCTGCGCGATGGGTTCTATCAGATCTTCATGCGTGAGAGCGATATCCCTCTAACGGCCGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGAT
GCCGCAGGGTCTGATGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTATTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGGATGTGTT
CGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCACTCATGCGCAAGGACAAGCTCTTCGCG
AACCTGAAGAAGTGCAATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAATGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTG
ATCAATGAGTGGCCGACGCCGTCGAACGCCAAGGAACTGCGGCAGTCCTTGGCTTGGCCACGTACTTGTGCAAGTATGTGAAGGACTATGCGGGCACGAT
TCGCCCGCTGTCACAGCTCCTGAAGAAGGATTCCGAGTGGAATTGGACAGCAGGCCTTCGATGCAGTCAATCAGGGCTTGACTGAGGCGCCGATCTTGGC
GGTGGCCGACCAAGACCGTCCATTCCACGTTGTATATGATGCATCCGACTTCGCAATCAGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGT
GTCGTCTACTACCAATCGCGTGAGCTGAAGCCAGCTGAGCGCAACTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTGC
GAGTGTACTTACTCGGAAGCAAAACGTTCGTGGTCTATACGGACCACGCGTCGCTGCGGACGACCGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAG
ATGGCACTCGTTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGCGGTGGCCGACGCGTTATCGCGTCGACCTGACTACGCT
ACGACTGATGCCGACGTCAATGCCATTGACGCCATGCAATCGAGCACCCCAACGTCGTCACTTTTGAACGACGTGAAGGGCACGACGCGGACGCGAAGCT
CTTGCTGGCCTTCGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCATCGTGCTCGTGCACACCGTTACCGGGTGCACGGCGGGTTA
TTACTCTGCAGTGCAGTCGACGGCAACGCAGACCGCGTTGTCGTGTCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGA
ATGCAGGGCATCCGGTCCGTGAGAAGACCTACCTTCTTCTTACGCGGGACTTCTACTGGGCCCACCAGTATACATGGGTGCGCAAGTACGTCCGTGCTTG
CGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAATGTTGGCAGTCCATGTCTTTGGACCTC
GTGTTCGGTCTTCCCCCGGACAGCCAGGAGAACACAGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAG
TGACTGCGAAGCAGACGGCGCGTCTGTTCGTCGACTTGGTGTTCAAACACCATTGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGC
GCACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGCCAACTTTCGATGTCGACTGCGTGCCATCCGCAGACGGACGGGTACACCGAGCGCGTGAACCGC
GTGCTCCTGAACGTGCTTAAGAGCTACGTTCACTCGTTCCAACACTGGAGTGAGTGCCTGCCGATGGCGGAGCTCGCCATCAACAACTCGGTGCATGCCT
CGACCGGGCATACGCCGTTTTACGTGAATGTCATGAGGCACCCACGCCTCCCGAGTCTACTCAGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTAC
GACTGCAACGCAGCAGCCGAAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACCACGCTTAAGAAGAACAAGAAACACGCGTCTGTGCAGGGCACA
GACGCCAACAAGAGCAACAACAACAGGAAGTACGGGTATGTACCGGGCACAGACACCGCCAACATGGACACAGAGGCCGGGCCTACTGCTGGAAGCGAGC
TGAACAAGTTCAGCTCGGACGCAATCAACTTCGTACAACGCAGACAAGCCGTCATTCGGTTTGTCCAACATGCTATAGCAGCCTCTGTCGATCGACAGAA
GCTGAACGCAGACAATGTTGGTAGGGGCAACAGAAATGAATTCAAGAAGGGTCCATTGACCTTGTTAGCTACACAAAACCTACCGAAACATGCAGTTTCC
GACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACAGTGTTGGCACGGCATGGCAACGCTTACACGCTAGACATTCCATCTAGCATGC
GCCTCCATCCGACCTTTTACGTCGGGCGACTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCGGCGGGAGCGAAC
CTCTGCTCCAGCGCGCTCACGCGCTGGGCCAAGCGTACGACGCGACCTCCCACGTCGACGGAGATGCCCGACGCGGTCTGTGAGCCCTGAGCGACTTGAG
CCCTCAGGATCGACACCTCCTTCTTCAGAGCGGCGAACT