Description :
From Genome Similarity Track
Location :
Scaffold_458:16225- 19421
Transcript NameFunction/comments
Phypl_g8524hypothetical protein

Sequence
3196 bases(100 bases per row)
TTCAACTggaccagcagcggcatgtATCAAGACATGAAGCATGGCTTTCCCATGGGCAATGATGGGGTGCCCACCATAAGTCAAAATACTGATTGTCATT
CCAAACGCTCTTTTCTGACCTCAAGGTCGGCAGCAATCAGCAAATCCCATTTCGAACCGGCAATTACTGTGTAGTCTGAGCCAGTACCCGGGCAACATGG
CAGCTCGAGTACACCGTTAATTGATCCAGTACGTGTTGTAGGTGGCAACAATTATCCGAGGCGCTTCAAACGGACTTTCGATTCTTTTTGGTGTCACGAA
ACTTttgacgcagctcctgctttCAGTTTCTGTCGCGACAGGACAGTCATTCAACCAGTGCATCGCCTAACACTTAGGACACGGAGACGGATGATTATGG
ACCGGATTCGACTTGCCTCTTTTAGTACTATGCGAGGAAATTGGCGTGCTGGCTGTCTCTTGTCCAGCCTCAAACTTCACCTGGCGATTCTTGTTGAGTA
AACTGGTCCGCATAGATGAAACTGGGCTAGCTGGCTTAGTACCAGGTGACTTAGGTTTCTCGTCAACACGGCTAGCACAATTCTTCTTTAGTCGCTTGTT
CTGCTGGAAATACCGCTCGTGCTCTTTGGCTTTCTCACATACGACATCTTAGAGCTTCTTGAGATCCGAAACGGCCTCCTTGTTCTTCCAGCGAATAATT
CCTTTCACTTCGGCTTTAAGTGCAGGCGGGGCAAGCGATGCCATCAGGCGTTTGCACCTCTCTTTGTTGCCATCGGCACCGGCGAAACAGTCGTCGAGTC
GATTCTCCTCAACAATCTCATCAAATCGCTGGAAACACGATAGGACTCGAGCATCGACGTCAGATTCACGAAGATCCATTTGCAGTTCACGCTCGAACAA
CGACTTAATATATGGAATATCATCATACTTGACCCTAGCTAGCAGACGGTCTAGTGTATCGCATCAgtggcgtcctccaccttgaTTCTCAAACTTAACG
TGCAGAACGTCTTCAACAATCGTTTCGATGAAATACCCCTTAATAGGCTGGGTTACAAAGTCAAAATCTTCCCTAGAAACTCGGACACGAGCGCGCATCT
TCGCTTTATATTAACGTCGCAAACTACGCCACTTCAGAACGCTTCGTGTGAGATCGACGTGATCATTGGAGGAACCACAGGGGCGAAAATTGGGACGGAG
TATTTGTAGGActtctcctcgtcatcatcttcagcatgACGCTTAGTCATCAGACTCCTTCGGGCTGCTAACGACACGAAGTCGAAGGCAAATTCCACTA
AAGAATTCTGTGTGATGTTTTCCGGAAGTTGATCGAAGGAAACGTGAACACTTAGCAGGGGAGGTGGCAAACCTGCAGGAAGACTTGTTGCCAAATATAT
TGGTTGATCACTTGCGTAGCTGGACGCAAGATCAAGAGTGAGTGACATCTATCTGCGAGTCTCCTGAACGAGGCTACTGGCTACACCTTGTTGTTGGCTG
CCAACGGCTGACTAGCCGTCGGCAACGACAGACTAGCCGTTATTGTTCCTTGAATCAGATATCACCGGTAGATGTGACTCCTGGTGCAAACTGCTTCATA
CTGCTTGATACCCACAACTCACAACAGAAGAAGACAAACCGATGGCCATGCTTAAAGTGCTTAAAGTGCAAGTCAATGATGACTTAGTGAAGCATTGTCC
GCAGGTACAACCGGATGGGGCAAAACGCCTCGTGGAGGAGTTTCGTGCTTCGCGGAACAGTGCTGCATCGGCCTTATCGAATCAACCCGCAACGACAATG
AAACGTTTGGTGGATCCTGAGAGCGCGGTCTCTGAGAACAAAGACGAATTGTCAGTAAAATATAATGTTGACGGCGATCATGGTACAGTAGATGCGACTG
TGTTGGACGGTGAGGGCCTCCCTGCTGGACTCCGAGGCAAACGCGTCGACTGTTTCCCAAGGTTTCGTGTCCGAGCTGCACAACCACGGTTGTTTTATAC
CAATTATTAAGCGAGAGAAGCCGAAAGAGTTTGCCCCGTTTGGCCCTGGTACTGTGAAGCTTTACCATCGAAGCGCGTTTTGAGGAAATGCTTCTTCATA
CGTCTGTGGGTCCATTGGTGCTCCGAAATTTGGAGTGTTGGATTGATGAATCTGGCCGTTCAATGGCATTAACTGTCGGCCGATCCGTAATGGTGGCATT
GGGTTATTCGACTGATGAATTGGCTTTGGAGAAACAAGCTGAGTTCGTACTTCCACCTAGAAATGACGTCAACGAATCGCCGCTAGTACGAACAACTTGG
TGAAGTGGCTTGCTGTTACGATCCCCCTAAAAGTGATCAGGGTCTGATCGGGATGAACGTTCTGATGAGTGGGTATTTTTTCTGGAAACAGGTCGGGTGG
ATACAAACGCAGAATTGGTTCGTGAACATCCGCAACGGGCACGTCTTCGATAGGGAAAATCTATGGAGCTCAAGCTTAGGGAGCTCGAGGTACCCATTAC
TAAAAATGGAGAATCCAAGAATGGGTAATCCAAAAAGACTAATATCTAAAAATGTATGAGCATTCGCGATATTGTACACTACCTTAGACTGAGAAATAGT
CCAAGAGGTTGAAGTGTCCAAGCAGCTTATGCAGCGTCGGTACTATTGATGCAGCGACACACCCAGTAGTTTTCAATGGTACCCAGATACTGAAAGTACT
TCCTCAATCTGACAGAGAAGGCCGGAGCTTCCATACGGccttaaccctttcgtgacaaaaaGGCGCgcactgcgccctttaagaggtGTTTTCAAAACAC
GGTCGAAAAAGCCGTCTAAAAGggagcgcccttttgcacaagttcaaaTTAGTCTATACCGTATATAATAGCATAACACAAACTGTACAATCACTAATCA
TGTAGGCATACTGAAATCAAGGTAGGTGCATATATCTGTTACATCCAGCAAATCTTTGAAattgatatgttacaagatATAGGCACTGACATTGCCGTGA
TTTTGTACAAGGTCGCTCACTGCACCCTTTAAGAACCAAATCACTTAGCCTTatatactatagtttacctaagtggcTCGCAAAATGGTTAAAATAGTCC
TGGAAGTTGCCATAATTGAGTTAATTTCAGTATCTACTTTAAAATAGCTCCAACCGTTACCTTCCTACTGGCGCTGTCCTCGAAATAGTCCACAAA