Description :
From Genome Similarity Track
Location :
Scaffold_360:16220- 26154
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_360-fgenesh-gene-0.1HECT ubiquitin ligase
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_360-abinit-gene-0.38Rraga protein

Sequence
9934 bases(100 bases per row)
AATGGCCCAGACCATCTTGCCTACTACTACGCCACAGGGCGGCTAGTCGGGCGGgCTCTACTCGTAGGAGATGTCGTGAGTTTTCACTTCTGCACCCCAC
TTCTGAAACTATTCCTCGGGATTCCGGTGGGATTTGATGATCTCGAGTCGGTGGATCCTGTTGCATTCAAGAACTTGATGTGGCTACTaGAAAaTGATGG
CGTGCAGTCGCTTGGACTAGATTTCACTATGACTGAATCTGCAAGTGACGGCATTGTTCGGACTGTGGAGCTCATTCCAGGTGGCAAAAGCATTGATGTT
ACCGATTCGAACAAGCACAAGTACCTTGAACGACGACTTCACTACACGCTTTTTGAGAGTGTTTCAGTCCAGCTGCAAGCTCTACTCAAGGGTTTCTATG
AAGTCGTTCCGCAGCATCTCCTGATGCTTTTCGATTGTGAAGAGTTTGATTTCGTATTGTGCGGCTCACAGGACATCGACGTATCGGAATGGGAGAAACA
TTCTCAGTGTTCCCCcAACcTTGTCGGCTCCCGTGTTCTCCGATGGTTCTGGGAGATCGTCCGGGACATGCCCAACGAATACCGAAGACGTCTTCTGCAA
TTCGCGACTGGTTGCTCACGCGTACCCCTCGCAGGGTTCAAGGGTCTGACTAGCCACGACGGTCGCATTTGCCCATTCATGCTCAAGGGCATCTCGTACC
ACAAATCCCAGTACATTCGCAGCCACGCCTGCTTCAACCGACTCGACTTGCCCATGTACCCGACTCGAGACGAGATGAAGACCGTGATGTACGGCATCCT
GGACACAGACATCCAGGGCTTCACCATCGCATGACGTGAGAACCCGCGTCGAGATGAACAGATAAAATCCACGATGAACTGAGGGACTCAGAATTAGGGC
TAGGTCGGATTTCGTTGTTTTTGGTGGATTCGACCATCACTCCTGTTTACGCTGCCGAGTGTGATGTGTGTGACACATGACCGGAAGAAGCGACCGGGGA
TGGGCGTGGAAGCCGCCGGCCGCCGGCAGAACGCGACGTGCGGACGGAGACGATGGCGGACGCGGACGCCAACTCGATGTACAGCTCAGCGCTGCTGTAC
CAGGCCGTGATGATGCTGCTGCTCTGCATCATCTTCATCGTCGTCTGGACCCGCGGGTGCAAGCGAGATACGTTGCTCGaCTACCGCACGCCGCTTTTGG
AAGAGTGAGTGCGCCGCATGGTTGGGCGGGAGGGCGTGCAGATCGGACTAAACGACTTGATGCTTCTAGAGATACGCATGAACATCGCATCGACGCAGCG
ACGCGAGAGGCAGAAGAAGGATATGCGCTTTGCACGGCATGCTCGTTTGAGAACTTCAAGCGGTTTGCGCATTGCACCATTTGTGGGGAAAACCTTGGAA
CAAGCGAGGATGGTGCGGGTGAAGTCAGCGCAGTGACTCCTTCGCTTGCGAGGAGGATGAACGCGCGCCAGTTACGAGCACGGTGAGTGAAAGCGCGATG
GACGAGTGCATGAACAACGTGATGAGAGTGAATGCTGGCTACTAGGAAACGCAAGGAATGGACTCGTGTGCTCAATGAAGATGGAGAGATGCGATGGgCA
aGAGTTGCTGTGGAAGATCAGTATGATCTGgCCCCGGCATTTGTTGCGACCTTCCCCAAATCtCCCCGGAAGGATGCTGCAgTCGACGGTATCGAGACAA
TTCACGATCTTCTACTTCATGAGGTTGCTGGGCATTCTCCGGTTCTACTTGAAGCACTTGAAGCCAATGCAGCTTCATTTCCAACAGGATACGAGTTTGA
CTCGGACCGTGACCGTCGCAACGAAATCGTGCGTCTCTCGGCGCTTGACTTCCCATCCAAGTACGCTCACTTCGTTGTCGCTACTTCTACACACGCCATT
CCAGCAGAGATTGAGTTCATGAAGCTGTCGCTCCATCGCAACTACGTTTTAGAAGAATCTGTTGATCATCTCTGCTGCATACAAGAAAAaCACATCAAGT
CAGTGATGCGCATTAACTTCCTCGATGAAAGTGCTGTCGATGCTGGCGGTGTCCATCGTGAGTGGATCATGCTGGTCAATCAGTTGTTGGTTGACTCACC
GCTGCATTTGTTCGTGTGCCACAATCGCGTGGACCAGTCGTACCACATCAACCCCAACTCACGTCAAGATGTTGGAGACGACCATCTCAAGTACtACTTt
GCTACTGgCCGCCtGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNaacacccCtggGCGCCAGTCATATCGCGCTTtCGTCGACATGTCgCCGTCCCATCTGgaGgCGCAtCtCCAGTTGCAT
TAGTCGAAAACTCAGGCCGCAaaaGTCTTTCCTTGtGCTTTATAACTCCGGCAATTCAGTtACTTTTGTGTCTTACAATGCTAGTGGTCCTGATGACGAG
AGAGCCCGAGTGATGGTCTGCGCAACCAGAGCTCTTGAGGTCCCTCCACATGCACGCACCAGCATTCGTCCGCGCTCTCGCCTTCACTTCGAGACTCGCA
CTACTTCAGAATCACCATAGTTCAAAGCAGCCATGTCGCCGGAGGAACGGCTGCTCATTGGGCTCTTTGTGGTGTTCGTGCTTGCCAATTGCGCGTGTCA
TTTCCAGCTTCGGCGCCAGAAACGCGAGTGGGCCGAACTGCATGCGCCTCTCAATCCTGAGTGCGTGTGGTTTATCATGGCAATACGAAATGGACAACAC
TGGACTGACTGCGGCTCTTTGCCACTGTAGCTCTGCTGGTAGGCGGCTTGATGCCGCTCTGCGTGAAGCTCAAGCCGGCACTATTGTGTGCTCGGGCTGT
GGCTTTGAGAACTTCCACCGCAGCATCTTCTGTTCCATTTGTGGACAAATCATCGGCACACTAACCAAGCGACAGAAGAAGCGTATGGGCAGAGAGGTGA
TTCTGGGCAACGCCCGTCGTCAGCTAAGGGCGCGATGCCGCAAGGAGTGGACACGGAAGGTTGACGTCGAAGGCAACCTGTTCTGGTACCGAGACAATGC
ACCTCTCAGCTGCCGTCAATATGCAGGCCATGTCATCCGcTTCGTGCGAACTCAACTTGATGTCCAATTCGTCGAGGGGACACAGGACGTGGGGCTTGAT
GCTCATGCGCGCCGTCTTGTCGAGGACCACGCCCGGCATGTGGTCCACTCGGAAGACCCGAAGACATCGGATCCAACGACGTTCTTCTCCGAAAaGCCAG
ATCTCGTAGCTGACCCTCAGCTCAAGCATGAGTACCGACAACTTGTCGAGCACGCCCAGCGGGACTTCCcGTCCAAGCTAGCCGAATTTGtGACGCGTGC
ACTGAGTTTGTTTATCGACAGCGACGATCtCGTGTCtGTTTTCCACATCCACCGTGCTTCACTGTTGACCGACTCGATCAGTTCACTTGCCTTGCTCACA
CCAACACAAGCCCGAGCCGCCATCCGTGTTGACTTCGTTGATGAGCAGGGCATTGATGCCGGTGGAGTATACCGTGAGTGGTTCCTATTGCTCAACGAGG
AGCTCGTCAAGCCAGAGTCTGGAGTGTTCACTTGCGTGGACACTCAAGATCAAACCTTCTATCTGAACCCGCAaTCACGTGCAGTTCTTGGTGAAGACCA
CCTCATCCACTTCCTTGCCGCTGGCCGATTGATGGGCCGCGCGTTGTTAGAAGGCAACGTAACAGGGTTTCACTTGGCTCTACCACTGCTGAAGATCATG
CTTGGTCTTCCCGTTACATTCAGCGATCTCGAGTACTATGACCcAGAGGCATCCAAGAGTCTGAAGTGGCTCCTTGAGAACAAGGATGTCGACGCCCTCG
GCCTCGACTTCACAGTTGTCGAGAAGCTTCCAGGGGGCAAGACCCGCGTGATTGAGCTCGTGCCCAATGGTGCCAATATTGATGTCACCGATGCCAACAA
GCGCGAGTACGTGGACAGGAAATTGCAGTACTTGCTCGTCGACAGCGTTTCCTCCCAGATGTTTGCATTCCTCCAGGGTCTCTATGAGGTGGTGCCAGCA
GAGCTGATGATGCTGTTCGACGCCGAGGAGCTCGACTACGTGCTGAGTGGCTCCGATGAGATTGACGTGGACGACTGGGAGCGCAATACCAAGTACTCGC
CTGACCTGTGGAACCACCCGACACGCCAGTGGTTCTGGGAGCTCGTGCGTGAGATGCCCAACGAGTACCGTCGACGCCTGCTGCAGTTCGCCACGGGCTC
TTCGCGTGCACCCTTGTCAGGCTTCAGCTCCCTCACGAGCTACGACGGGCGGCTGTGCCCGTTCACGCTCGTCGGTATGCCCCTcATCGATGAGGGCTTC
GTGCGCAGCCATGCGTGCTTCAACCGGCTCGACGTGCCGCGCCACGTGAACAAGGCGTGCCTCAAGAAGGGGCTGTACGCATTGCTCGACACGGAGATGT
ACGGCTTCTCCACGGCCTAGAGCATGTGAGCACAGTCGGGCGGATGGGCTTAGTACACTCACAGACGAGACAAAGGGGATGCGAAGAGGCGCGCCGCGCG
CGTCATGGGCGACATGCAAGTGGACCGCCACGCAGGTGGAGCGGCGCGAGGGACCAGCCAACCcGCCACGCCCCACTGACTGCCCACGTCGTCACACTCG
CCACTGGGAGCCTGCGCATCCAGTCAGCGCACTCTGGCATCCTAGTGCCGTACACGGACCTGGCGCGGGCgCCCGCATGGCCATACTTCGAAGTCGTAGG
GAGTTCGGACGCTCTTGCTGCTGCCTGCAGGAACTTCCAGCGGAACCGTTCCTCTGGAGCGGCGGGAAaTTGAAATGCAGATCCTCGCCTTTCTGGCGTT
GGCATtCATTATTTtCTtCATCAACAaGCATAACAGAACAAaGAACATAATGAGTCGGTGTTGGTTTTtATCATCTCAGTCCACTCAAGTTGCTGGCGAT
TCTGGACGTTCCGTTCGACAAACGAGTACTGTACTGTAACGTTGTGCCTCAGCCACGGGTGGACGGATGTGAGTCGCACCGTGCGACTGACGaCTAAGCG
CAGCTGACCTGGTCCAGAAGTGGGTTCTACGTTCATCATGGCGGCCAAGCAGATGCTAGAGTTGAAGTGGATGCCCCTTGACATCAGCGATTGAAGAACC
CACCGGCTGAAGCGACATTCCCGTGACGCACTCTGCTCTCCTCTCGGTTTGACTTCGTCTTGGTGCTCTGTGTCTCTCCCATCGCGATTTTCCATGGCTC
CAAGATCGTGACAGGTGTAGGTTCAAGCCCAGCGACGGCAACAAATTCAAGCTTCGATTTTTTTtAGTTtCGCAGTTCCACGGTTCAGTTCCGCCACATG
GCTAGTCTCTGGCCACTTCAAGCCAGCACTGAACACAGACTTTGAAGTGACAGCACAATTCTTCACCCCCTAcATAGAAACGCACAAtCAATCGACGAAC
ACACACTTTtGGGACTTGTGCTACTAGTGTCCAGCTGGTGGCCACTTTCCTtCTtCGTTTTTTTTttCTtCCACACACTGAGCAGTCAGTCGTTGTGGAG
ATGGGCGgCGTCGCAGGTCAgCCGGGAcTCATCGGCcGcAAaGACCCACGCCGTcACCACTCGGCATTtGCCTCTCATCTGCATCTCTCTGCACGGCgCC
AGACGACcGGGgCAGCAGAGATCCGCGgCTGAGCTCATAGCGAACCcTACcGCATTCGCATTACGCGCATcGAACCCCCCcAccAtGCAGTCGCTGCTCA
TAGTCGGCTCCGTATTGCTCTGCATGATCTGTGTCTGCGGACCCTTTGTGCTGCTAAGGCGTGTCAAGCAGAGGCACCGCCTGCTCATGCAGTTGCGCTC
GCCGCTGCTTGACTCGGAAGACCACCGCCTGGACGCGGCGCTGCGCCAGGCCCAGGGTGGCTTTAACGTTTGCACGGCATGTGGCTTTGACAACTACAAG
CGCGCGACGTACTGCACGATCTGTGGCGACGAAATCATTGACCCGACACGCGAGGCGGACCCGCGCAAGCTCAAGGACAACAAGAAGCAAGAACGCAAGC
GCAGTCTGCGTCAGCTGCTCTCGTTTCGTCAGAAGCAGGAAGCGCGTGTGGCTGCGCGGAAGCAGGAAGAAGAGGTCACGCGCGTGCGAAGACAACGACG
CGCTCGGATGCGCAAGGAATGGCAGCGCAAGCTCGACGTCGAAGGCCGCATGTATTGGTTCCGAGCAAGCTTCGGTCGCCCCGCGACTCTTGCAACGGAT
GCTCGCTCGACCCTTCTGACAAAGGGaTACGTGCTACAAGTGGAGAAGAAGCGCATCGTGTCTGTGATCGAAGAGATGGATAAGGATGAGCGTCTGAGCA
CGACGGAGACTCTTCCGGCGTCGCCTCGCGTCTCGGAGGCCGTGTCCGAGCCTCGCACTGCTGCTGAGCGGACCAAGTCCcTCCGCAATGCCTGTgAGGG
TGTTCAGTTTGACCTCgTGGACTCTGCTgCGGCTGATCCGACTCGtCTTCCGACGGTCCAGACGCCTCTCAGTGACGCACAGAAGAAGGATATCGTGGCA
CAGTTCAAGCGCGAcTTCCCATCTAAATATGCCCAGTTTGTGACCAGCTCGGCGGGGCTTCTCATTCCAGCTgAAGTTGCCCACTTGCGTCTGAATGTGA
ACCGTAAGCGGGTGTACGAGGAATCCATTGCGTCGTTTGCAGTCATCCACCGTGAACACATGCGCTCCGTCATGCGCATCAACTTTCTGGAAGAGAACGG
TATTGATGCTGGTGGCCTGCACCGCGAGTGGTTCGCGCTGTTCGTTGAGAAGATCGTCGACCCAGCCACTGGACTCTTTGTGTGTGTTGACCGCACGGAG
CAAACGTACTATATCAACCCCAACTCGCATCGCGATGTTGGTGAACACCATCTCATGCACTACTTCGCCACTGGTCGTCTGCTTGGACGCGCTCTGATGg
AGGGCTATGCAACGGGTTTCCACTTGGCGCTTCCTTTGCTGAAGATCATCCTCGGTGTGCCAGTGAGTTTCAGTGATATGGAATTCTTcGACCCAGAGAC
ATACAAGAGCATGATGTGGATCCTCGAGAACGATGGTGTGGAGCATCTTGGACTTGATTTCAGTATCTCGGAGCAGCGTCCAGGAACCACTGAGTTCGAA
ATTGTcGACCTCATTCCAGACGGACGCAACATTGCGGTGAACGACGAGAACAAAATGGAGTTCCTGGAGCGCAAGTTCAAGTACATGATCTTCGAGAGCG
TTGAAAGTCAATTGTACGCTCTTCTGACCGGCATTTACGAGGTCATCCCGCAGGAAaTGCTCATGGTATTCGATCCAGAGGAGTTTGACCACGTCCTTTG
TGGATCGGATGAAATCGACGTCGACGACTGGGAGAATAACACGTTGTTCTCGGACGACCTGCACGAACACTCGGCCCTGAAaTGGTTCTGGGAAATCGTG
CGCGAGATGCCAAATGAGTACCGGCGTCGTCTCCTGTTATTCGCGACCGGATCTTCTCGAGTGCCGCTGGCGGGCTTCAGTGCCTTGACTAGTTACGATG
GCAAGCTGTGtCCTTTCACTTTGAAGGGTGTGCCACTTGTGAACGACGGCTATGTGGTGGGACACGCATGTTTCAACCGCATTGATCTTCCTCGCCACGA
GTCCAAAGATGACTTGCGGACAGTGTTGTACGCGACACTCGATTGTGAACAGTATGGCTTCACGACTGAGTGAGCCTATTTGACAACTAAGTTATTTGCT
TGGATGAAAAAGCTGGAAAATGGTAAGTATATACGAACTGTAGATATAACACGAAGAAATTTATCAAGTGATTTGAACATATGCCTGTGGAGTCATAAGT
CGATCAGGACGTATTGGCACGATTACCAAACACGATTCTTGGGTCCAGCCTAGCTCGTTTGCTGGACATAGCTCTCAAAAACTGGACGCGCAGCCTTGAT
GTTGAGGTGGATAGTAGCAGGCTCTGCAAAGTGAACAACACGGTGTGAGCAGAGCACGTACTCGTCCAGATACGGTCTGAGTTGGCACTTACGGATCTTT
TGGtCAGACATGATGACCATGATGTATGTGTTCGTCGTGAAGAAATCGATGAAGGCGGTAAAGTTGGAGTTGCGCACCTCCATGCCTTGGAACTGTGCCT
GCGTCTTGCTGCaGCTAAGCTTGAACTGCTTGATGATGTTACTGATTTTCTCGAATCGATGGATGTCTCGGTGGGTCGCATGAGTGGCGTGGGAGATGAC
CaGGAAAGTTGCGCGTTCGAAGAGGACGACCTCGTCGGCATTGCAGACCGCACAGAAATCGTTCAGATGAGTCTCCAGATCTTGGATGTTTGGAATTAGT
GAGTACACAATCGACGACCACGCGCGATACAGAGTCTCATCCCAGATCGAAGTGCCGAAACAAACAGTCGGAAGGGAGCCGACGCGCGACAAAATCATCT
CCTTCTTTTGCTCAAAAACCTATACCAGCGAGCCGTCAGTACTTTCCCATACTTTTCCCCTTGGTGTATCCACCCGCTTACTCGGTCACGTTGGTCTTCA
GGCACAAGATCCATCTTGTGAATCAACACGAACACCTTGGCGTTGCTCGAGTTCTGGTCAATAGCTTCGAGGCAGCCGTCAAAATGGGCCAGATCTTTCT
GCATAGGAGCATACGCTTGTCATTCCCATGCAGTCACACTCCTAATAGCGATTGGAACATACGTCGATCTCACGGCTCTCAATGTCGAAGACATAGATGA
GAAGCTCGACACTTCGGAAGATGTGGTCGCGCTGACTCTCGAAGTAGTTCTCGTAGAAGGCATCCTGGCTACATGATGAGGACACGTCACCTTTCTGCTC
ACACAAGCGCCGACTATCACAGTCCACAGCACATACCCGCCGCAGTCCCACAGGTTGAGCACAAGGTTGCCCAAGAAACGCACATGCGAGTGCTCCACAT
CCACTGCACACAGAGGCAATCATCATTAGGCCCCGAATCAACCTGCATTTCTCACATCTCACGTCACGTACGAGTCGGTCCCAAACGCATCGTGTCGCGC
GCTGTGAAGATCCCACAACATCATTAGATCGATCTGGTCGACTGAATCCTCACGTGCTCTGTACGTACCCAGGTAGTTGGCGAAAATGATGGAGCGCATC
GAGGTCTTGCCCGACCcGGACTTGCCCATGAGCA