Description :
From Genome Similarity Track
Location :
Scaffold_304:16218- 27779
Transcript NameFunction/comments
Phyag_g4489hypothetical protein

Sequence
11561 bases(100 bases per row)
AGATGCCCATTGGCTCGCTCGACGAAGACTGCGAGTGCACGGCTCAGAAACGGGTTTTTCATCGGTATCGTCAGCTCTCGAACAAAGCGAAGCCTTGTTG
CGGCTGCAGCCccagctccagttgctgcacttgacgCCTCGCATTGAATTTCCAGCGTTTCAAGACTCGACGGCAGGTTAGCGACAGCATGGATTTCGTA
GAGAAATTCGCCAATGTTCTCGTCCAGAAACAGAAGTTGACAGCGATAATTTCCAGGCACTAGGGGGAGAAACTCGAGTTTCACCTTGGCTGATCCGTTC
TTTCGGATTGCCACAGACGCACCATTAAGGCCTGACGCTGGGATTAACAATCCTTCAACACCAGACGTGTTATCTCCACCGatactgttgttgttgctgc
tacttccTGAGGTGCCGAACTCTGGTAGATAAAACGGTTGTTGCGCAGAAACACACCATGAGAAGTCTCCTTCCTCTCCACGGTTCTTGGCAACAATACT
TGACCTCCTGCTTCCAAATCCAGCGGCATTTGGCCCCATTCCGAAATTTGCCGAGCTGGtctggatgctgcgtcggcgaGTTCCACCTCGTGATGCGGAG
GGTCCTAAACCAGCTAATCCATTCGAATTCTCTGCTCCTGACGGAGGcgtctgctgttgctgtgtcATGGACAGCTTGAAATTCGCGTTGGTTGGAAATT
GGTTCTCGATGACGATCTCTTCCACGCGCTTCTCATACGTCTTGGTCTCGAATTGAATAATGCGAACAGGTTTACGTGACACGATGTTCGACTCCAGCAG
GAAAACCATTGTAGCCCCGCCTCCACCTATTGAAGTGGTTCCTGCGATGTCGCCGCGGACAGCTTGAAAGACGAGTCGAGCTGTCACTTTCCTAGAAAAT
CGTGGGCAGAATGTAACTACGAACGCGACGGTCTTCCCAGGATCAAGCACCAACTCATTCGACTCGATAGTAAACTCACTAGCCGTagctccagcatcac
ttGTTGTTCCACCACCGAAAGGGGCGTTGCGATCGGCTCCATCCAAGAAAACGTGATATCGCAGTGGACGAGCGCTCGGGTTCTTAAGTTCGATGCTCTT
TTCCATCACTTGGCCTAATCCTCCTCTGAACTCGATTGTCGCTTTGGGGATGAACTGGGGAAgtgtctgctgcagatgaagaactaGCAGCAGAATCTCT
CGTCCAGTATATCCACAAAGGAATCGATCAGGATCTAGACCAAAGTCAAGTCCAAAAGCACCTAAGGTCTGTAACAACACGCCTGCTTGATGTTGTagct
gtgcagcagaaggaggtcTTCGTGGCCGTGCGCTTGACGACTCGGGCATCCATCGAAAGCAGTGATAAGCATTCTGATCAACTGAAAGTGTTGGGATGTG
AGCTGCTACGAGGTGGAAAAGCCAACGACCATCGCGCAAGTCCCGACcgatgtccagcagctgagtctcaagaagaagccccCCTAACGAAGCCAATGGT
GCAGTGGTCGGATGTTGCGGCTTGCGTAAGGCCCGGACACGATCGCATAGCCACTGAATCAGCACCATTTCAGCCTCACTGTATATGTTGCTGCCTTGGC
AAGCTCGACCAGTGGAGTTCGTCTGTACTTCACCCTTGCGCTTGTCACCACGAGCACTGGTATCGCCGGTAGATTTCTCGTTTCCGCCCTGAAGCTGCAT
CTGATACCCCTTCCACGTGATTCGAGACAGTAAGAAGCACTTAATGACCTGGTAGATCACTTTCATCCACGCTCCAGTACTCACCCCACGCCATTCGTTC
TTgagtgctcgtcgtcttgcAACAAATGGCATCGTCGCAAATGACGGTGACGACAGCAGTGCTGGGTCGGTTTGAGGGCTCTCACAAGCTCTTAAGTAAA
ATTCCTGCGCCAGAAGCTGTTCGGGAAACACGTCGTGTACCATGGCTCCGTACGACCGAAGAAAGCGCAGCAATTCGACGAATTGAGTTGTGTACTGAGT
GAGTTGGTCCTTCTTTGACGGTTGCACTACTGCCGAGGATGAAGTGGTTGAGGCTGTTGCATTTCCGGGTGTTTTGCCACGCCCAGTAGCCACGTTcgca
gcgtctgcatccTTCCGCTTATTGTTCGTATTGgtgccaccagctcctcgaagcGTAGGCACAGGGAGACCTCCAGGTTTCTTGGTACAGACCATGTCCA
GCAATTCATACAGCGGACGCCCTGCATTGTCGGTAAAGTCCTCAGGAAATCGAACGACGGGTGTCCGTAGGAAATTGGCGTTGAGATACTGCATCATAAG
CTGGATTTCACCCTCCGAGAATGGCGTGCTACTTGAAGCTTGCAGTATAAGCGATGACGCGGATTGAGTGGGGACTGCTCCTTCCTCACCCAACCCAGTT
GATGGATCTACAACCACAAAACCATTGGGTACTGCGTTTGGTTGGTGACCTGGAGCCGATTTCGCTTCCTTGTGTTTCTCTAGCTCTACCTGAGCTTGTT
GTACTGAAAGCAGGTAAACGGGAAAGCGACCTGACGCGTGCGTGTAGAACTGATAGGCATTGTTACTTGCCGCTCCAACCTCAGACTTGGTTGATTCCTT
TCTATGTTGTGCGCTGCGGGGGGAGTCGCTAGCATCGTCGTCAAATTCTGCAGCTAGTCCGTAGGTCTGAAGGAAATTGTAATTGGTGAACAAGCAGTTC
TCAGCACAGCCGGCCACGGGTAATGCGAACGAGTTCCCATCAGTATCGAAGAACTCGAGTCTCGCGTTAAATGCCACACTTGCAGCACTAGAGAATCGTA
ACTCCACTGGGAGCCTCGGACACGCCATGCTGAGCGTCTTGCCACGAGGAAAGTGCACTGTTAGTGGAGCCCGTGACGTATCGAGTGGCACACGACAAGC
CAGCTCAAGATGATCGTAGCCCGTGGCGTGAACGTAAAAATGTGCGCTTGCGGTCACACCCAACGGCACCGTAGGCAGCACAGCTCGGTTTGTCGAGAAG
GACAAATGTGGGTGaattccttctcctcgtaGGCTCAAGTTCACGTAATGTTCCCCATCAACCTGGAGCGACAGTTCGTCCTCCGCGTACTCCACTGCAT
CTAGCGGTAAGAAGCTCACTCGAACTGTCACCTCCTCCCCTGGTGCCAACTCACCTTTGTCAGGGGCGACATGAAATACAACTGCCATCGCACTGTTCGT
CGGGTTTGCAGATCCGATTCGCTTAGCGAGCGCAGCCCCCGAACTTGCAGGTCCGAcggttgcagcagcggcgccagcagcgaatgTTATGAGGTTCCCT
TGACGCAAACGTGCCGTGTCGATCTGCCATGGGATGGGTTTTTCATCGTCGTTAGTGAGCACAAGCTGCTTGGTGTAAGGTACTTTGCGGATTCCTTCGC
GAGTGATAACGCAGCGGTTGAAATGCAGCGTTGATGAGGAGAACCGAAGTCGCGGCACAATTGCGCGTGCTAGAACGCGACGTCTAAGTGGAGGTGCAGC
TCCATTTGAAGGGCCTGAACCCGATCCAACGCCGGCAATTTGAAGCGGGAGTACGAGATCATGACTACCTTCTTTCAAAGGGGTGAAGACAAGATGACAT
GATACGGTACCGTGGGGTGGTAAACAGATTTGCCACTTGGAGCATCGCGCATCCATTTGCAGATCGTCTTTATCACCTCCAGCTTCCCGGTTTGCTATTT
CTCGAGGTTTGTCGTCTGTCAACGGCACGAAAATATTGCTGGCATCTTCGAGGTGTGCGAGCAACCGTGGTGGTGTACCGAGTGCGAACTCATCGGAAAA
GATCGACGAACCGAGGTCGAGCTGTAAACAGGCTGGAATGGAGCTGTGGTTTTCCAATGAAATCACGCGCGGCACCGAGACTCCCAACACGACTTCCCCA
AAGTCGATCGCTTCTGCTGGAGCAAGGAAAACATCCGgtaccagcaccgacacgCTCACTGGCAGACGTAATACTTTGCCCCCGCGTAGTGTCACCACGA
TATTCACCTGGTGAGAGCCACCACTTCCATCCAACGTGATGGCTCGATGTGGCAGTAGCTTCACCGTGAGCTCTATCGACTCTTGAGGGTCGATTGCTCC
TTGTGCTGGAGTCACATGCAGTCCTATCGTTGTGCTCATGGACGGTGGCTCCAAACTCGCGTAAAACACAGCTCGAGTGTACATACCCAGATTGGCGACC
GTAAGTCGCTTTTCACGTTCTACTCCAACCGAAATCGTGCCAAAGTCCACTTTTTTCTCACGAGTTACGACCTTGACTTCAGGTATCAGTGCTCGGCAGT
TAAGGACTCCCTTTTGGCCTCCCGTGACGTCTAACTGGAACATTTGGTTCAGCCATATCGCCCCACTCCGTTGGGTGACGCCCATcgcagccattgcagc
tgcagtaaTAGTAGGAGGCGTGTGTACAACCTTGCAAACCATTGTAGCCGACGGTCCGAGCGTGCCACTAGATGGAACAACTTCGAATACCGATGCCAGT
GCACTATTCATGCTCGTTCCCTTGTCGGCCATCGTCATGGTCGTTACTGTCGTTGTAGCATTACTTTTTGAGGAATCTGGGCGAGTGGATCCGTCAGGGG
TTGCTAGCAGAGACAATCGGGTCCAAGTAAAAGGTGCTTCAGAGTCGCACGTGTTAGTGATGACAACTTCACGAGTGACCGCTGAGCTCAGGTCGAGAGC
TCCAAAGTCAAAACGCAATTCTTCAGGTGCAAGTTCGACGACAATGAGAGCgacttcagcgacgacggtgacTTGGCGCGGGTGGACGCCGTTGATCGAG
TACGTGATCGACTGCTGGAAAAATTGTTCTCTTGACGAGCAGAAGACGAGGTCGAAGCCAGCCTTGGAGCGTGGAGGTATAACTTGAGAAGTCAAAGCTG
TCTTGCGAGAGAGCTCTTCCAGCGGACCAGGACCTCCATCCTTTTGAGAAGGACCAAATGGTAGCGACACGAGGATATTGTGCTGCAAGTTGTTCTGCAC
TGTGAGACTGCGGGTTGCGCTCCCATTGACACTCAGACGGCCAAAGTTTAATGTCTTTGGACCGGACACcacttgctccagctcgccAAACTCCAACGTC
CTTGCACAATCCGCTAGCTCTGCTGGCGTGGCGGGCAGTGgtttgaacttcttcttaATCAAtttgaactcgtcgaaaaAAGTCTTCGACTGGCCAGTAC
CTCCTCCTCCCGCAGGTTGTTGACTAAGCCACAGTGGATCGTTCGGCTTGATAAGTGACGGTGGCAGTCGTAGTTCTTGAGGCTGTGGTCGACTGTCCCT
ATCCATCCCCAGATCGACGTCTTGATTGCTCGGAACGctgtcgtcttcctcctgATTGTTCCCACGAGCCTGAGCCACACTCTTTTTAAGTCCTTGAGCT
TTCCCTTTCCACCCTTTAGCTTTTGCCTCGCGTTGAGCCCGACACTGAGCCAGATAATCGTGATACGCAGCGCGATGGTCGGCACGTCGAGCAAGTTCCT
TGACGCAGTACGTCAGATGCGTATTGTTTGTCCCTTGGAACTCGAATTCATCAAGAGCTGCTGTACCATTCAGCGCTGCCTGTTCATACGGCGCCTGACG
CTGGAAGCGGCGAGATAGCTTCCCTTTCGTTTGCTTGGCTTCCTCAGGAAGTAGAAATTTGTACTTCGGAGCGAAGTCTGCGGGTAAGGCCAACAGACCC
CCTACAAGTCTCTCACTGGCAGGAGGCACAGGACCAACGACCGCAGCACGGCCGAGCACCTTGACTGGAATTTCTACCACTCCGTCGTTAATACGTAGAG
CCAAAACGCTGTTAAAAGTTCCGAGCTGCGTGGGTGCGAAACTCACCACGACACTTTGCGACTGGAGCACATCCAAACGTCCCGTCCGTGGATTTACCGA
GTAATGCGCCACCCCTTTCGGGACCTCAAAGCGGACAGGAAGACCAGATAGGTTTTTCAACGATAGCAAAATGTCGGCACGATCGTAAGAGCGTATGTCG
CCAAAGTCCAGAGGTGGTGTGGGAGAAAGTTGGAGTCGAGGGATGTACGTCTTGGCAGAGATCTCAAACGTCAAATTTTGAGCCTGCAAGTCCTCGCAAA
CGATGGATGCAAAGGCACTGAGTGGttgagctggtgctggtaagAGCATAAATGGAGAACTGGACGAGTCGagactgctgttgctaccTGAAGTGGGCGA
ACCGTAGTCACCGTCATCGAGCCCTGTACTGAGTTGCTTGCGCTCAATTCTCTGGATTTCCTCCGAAGTCTTCGCTCGTGGGTGATACATGAATATTACG
ACTGCCTCACTGAATGGGTCAATGCATCCGTCGGCAGGAGTTATCCGAAGCTCTTTCCGTCGTTCGTACGCTTCTCGATCTTCCTCAACTCCGTTTGGCg
ctcctcctgctgttgcGCCGCCACCAAAATTGATCGACGTCTTGAAATTCAGAGGTAGGGGACCATTATTCCGCAACAACGTCTCAATTGTGCGTGTCTC
CCCAGCAAATAGCGATCCAAAGAATAATGACTGCACAGGCTCCAATCCTTGGCGTAGTACCAGCTCCGCTGTGTGTTCCACGACGCTACCCGACACATCC
ACGATTTTTTCTGCcgatggtggagacgatCTTAAGTTCGGTGAGCCCAATCTTCTCGCTGCCACTCGATTTACAGCTGCctcatcctcctcgtcatcgt
cgtcttcaccacgTACAAACTCCCAGATCCGAACACGAACAATCCCTCGGAACGCTCCGACTTCGTGCCCCTGCGCTTCGACTTTGATGTTGATTGATTC
TTGTGGTGCGAGTTTTCCACTCTCAGGAAAGACGATAATGGCGGCGGTAGACTGCGGACTAGCATTCAACTCTCCCCCCGATTGATTGCCTATGTCCAGC
ACTTCTGCAACAAATCTACCTGGTCTCGCCCCCGAGTTTTGCACCTCCACAAACACCGCCGATCGCTGGGCCAACACCACCAAACCGAGTTCACAAAGCG
CCGGCGACACCTCAAGCAACGGACACGCGCGACGTGCCATCAATGGAACTTCCAGCATCGATCCGTCATCACCTCGTAGTTGTAGAGCGTCGTGCACAAT
GGCTGGGGTTGATTCAACTTCGAGTTCTGCATCCTCATCCACATTTTGGTCCACTTGTTCGAAGGTCACTTCGTACTTGACACTGAGCCCCGGCGGCAAC
GTGACGGTGGCATTCTCAGTTCGGGCCAGATCTCGACCTCTTAGAAGAACTTTGAATGGCGACGCGTGGGGTGGAGGGAACAACCGGAAGCGCAAAACTC
GATCGCTGGCATTGCGAACGTTCAAAGTCGCGACGTAGCAGGACCCGCGTTCGAAAGCCGAAAACTCGACGGCCGACGGCGCCACTTGCAGTGCGGAAGA
AGTGCGATCTCCACGAAGACCGCAAGGTGTTGATGGACGCCCAACGACGGTCAAGGTCGGCatcactgcaactgcaggaGCAAAAAAAAGATTCTCGAGA
ATAGTTGGTGTCCAAACCGAGAGGCGCTGCGTCGGTTCAAGTCGAAACGAGGTTTAAAAGAAACAAGCAAAGCACTACAAGAACGATGAGTTAACGCCGT
GTCGTGCTGAAGAATCTTGGCGTCTTCTTTCCCGTTGGTGGGAATTCACCATGTCGCTCAACGGAAAACAAAGCAAGAAACAGTATGAAAACTATGGGCC
TGAAATGGAGAAGCGGAAGCACTACTGAATTACGTTCTTCCTGGCGTGCCTTGTAGTAATAATCACTTGGTCACGCGATTTCCTGTTGGAGGATCTGGTG
TTCCGTCTCGACCTATTcctggctgctgctatgaTACCGCGGGAGGctccagcctcgagcttTCTTCCGTGTGTCCCAAATGACTATAAACTGACACACT
TTAGCAGGATCTACCAGCCCTCTCACGTAGCTTGCGAAGTTTCGGTTCGTCCAGCCACAATATTCACCAAATGCAAGCGCTTCGCCAGTCAGCCAGCCAG
TCGCTCGAGTCAGGTAGACGATCAAGCTCTCGATTTTGCCTTGAAAAGGCAACTACTATACATACTACTTTATTGTGGACTTATTACGCCGCTCCTTTTT
GGCTCTGTCTTCTTCGGTAACCccttcgttgctgctgtgacttctgctcctgcagtGCTGTACCCGTTTTCGCACCCTGTTTTGTCGCGTCTCCATGCTC
CTCCTATATAGCTCTGTGTCAGGcatttcctccttctcttcccgctcctgcagcagcgtcacacTCGGCACGTTCACCTCCAGAAACCCCTTGCAGCCAT
TGGCTGCCGTCGCCTCTTGATTCCACCCCCAACATGTCGACATACAAAGTTAAGTGATTTTGTTCTAATAGGGCGCAATCAGCTCTTTTTACCAAATTAC
GGTACTACTGCAAATCTATGGAAGATGCGCTGTAAAACTAATGCTACGTGGCAGTGCTTGGAAATGGATCGACGTTCTCAATCGCGAAGCCGGTCTCCCA
TGGAGTTGATCTGTAACATCATCACGACACTTGTCAGCTACTCAAATTGTTCAAAATCGCAGCTTCCCGTACCCAGTCAAGTTCCTCCTTTGCTGCGTTC
TGAAGCTTGTCGATAGATCAACCATCTCCTGTTGGTGGGCAAACAGTTCCGCCTCAAGCGACCCCACCAAGCGTTGGTCATACTGTTTCAGCTCCGCTTC
GACTTGTTGCAGGCGGTGTAGCTCagcttggagctcttggacctgcagcttctgtcgatgttgctcttgctgcattCGCAGAAAATGTTAcgtttccttc
ttctcctcctaCATAACCGAGACATGTACCTTTTCGAGTTTGCCATGGCTGAGtgttgctgtttgtgctTGCAGTCTGTGGCAAAGCTTGTTGCCTTCGG
TGGTATTCAGGGCGCGCACGTGTTGCCCACTTGGCAATCTCTCAGAGTAAGTGTCGAAGTTTGCGTCTGGTGAGGAAATGTCTTGTGCTTCAACGCCACT
TTCGATCGTAGCCGCGTTTGAGCTACAAGTACAGAATATTCACACATTCAGATGATGTTAGGAGGATCCACACAAGACCAACCAAAGCTATTGCTAAAGA
ACGGGTTAGATAGGACTCAGTCTAGTGTAGGGAACAAGGTGGCATGCATCGATCGTGAGATCTGCTGTGCGATGCCTAGTTCTTCATTAGCTCTCTGCTT
CCCATCCTGAGACTTGTAACTGTTATTGTGACTGTGATCGGAacgagaagatggtggaACGGGAATCTTTGCCCGTCAATTTCGATGTTATCGGTGACGG
TCTCGCCCTGACTGAAGCTGCGCACAGAATTATTAATTAGGTCGGAGCACGTatcgtgtttgctgctgccttggGCTATAGGAACTGGGCCTTGGATTTG
ATTCGCCGCCAGGAGCCCTCGGATCTCCGACATCACCAGCAGGTCCTCCACAGAACTTCCGAAGACGTCGGAAACCGATGATGGCGAGGACATGTGAAGC
AAAACGAGAGGAAAGGCTCGAGTTGGGAGAAAAGAACTGAAGAGTGCGAACGATGTGCGGCAGATTACTACGTTCACTGTCCACTTGGGACTGCTTGATG
CTTGTTTCAGTGTTCATTGTCTCACTGGTTTCATATGACGAATAAGCTCTCGAATTATTCATCACATTCCCTTACTTGCACTGACGACGCAACATCACTT
GACAGCAATTCCGTGGTTGCAGCAACTACTGCAGTTTATTGATTCAACAACGAGTTTTGAGCTTGTGAATATTTCTAAGTTGGCTAACGTGTAAGTTCGT
TCAGCAATGGTTTGGCGGTTTGGCTGAAACGTTTTACTTGCGGAGACGGGTGCTCATCAAGTTGATCTAGAGGTAAACATCGATCCATTAGTACTAATCA
ACCATCCTCCAAATGAAATACCGCACCCAGTCGAGTTCCACTTTTGCCGCGTCCTTGACTTTTTCCGATAGATCTGTCACTTCATCTCGATGAATTctca
gctcttcctgcaggGACTCGATCGAGCGTTGCTGGTATTGTTTTGCCTGCGCTTCAATTTCTTGTAAgcgcaccagctccgttTGAAGCTCCTGAATCTG
CGTCTTTTGCTGTCGGTACTCCTCCTGCAGTGTCCACAACATAGCATTGTTAGCGGTAAAAGCCCTCAACGATTCTAATGTTTTTGCTCGCCTTCTTTCG
CTTCCGATAGCGTCTCGAAGCCGTCTGCATCCGGAGTTTGCGACGAAGCTCTTCAAATTCGGCCAAGTTCATGACATGGATCTGTTGTCCGGTTGGTAAA
ACTTTGGAGGATACATCAGAAGATAAAGCTCGTGCTTTCTTGTGTGGTGAAGATAATTCCCGGGGTTTTTGTGAGATTAttgatgctggtggcgcaATAG
GAATCGAAACTGGAGTTGTTGTCTGGCCTGGCATCATGCGCGAAGCTGCCGGTGTTGGTGATAGATTTGATACTGGAACTGGTGCAGCGGAGGCAATCAA
GTCCACAGCTCTAGTAAAGGACCGAGAAGCTGCGGGATGATGCCTACAAAACGAGGCGAGGCAATTTAGTGTTTAAGATATGGCTTTGGTTTAAAAACCC
ACCATGCAACCACTTACGCTAGCGGTGGAAACCACGAGGTGAGGTTATCAAGAGGAGACTGAACTGGAGGTATTTGCGCCGCAGGGATTGGCGACAGGAA
TGAACTCGGCCTATATGACAGCAAAATACAGCACGAACAGAAGCATTGACGCCAACACAAGTTAGAGACTCCTGTACGCATTTTTTCATCAAACTATGAT
ACGTGCTTCTTGCTAAAGAACGGAATGAGTGGGTTAGGCATACAACACGATGGAGTAGAGAACAAGGGGAGCATACATTGCGTTCTGCATCTGCCGAGCG
AGGCCtagtgctgcgtctgctccttGATAGTGCATTGCTTTGTGTCCTGCTGGGAAATTTTCCTCGACGTAGTCGTCATTAGCGGATGCTGTCTCCTTGT
TCGATGGACCCCTtccttcttggtctccattATCGAGAGTGCTATCTACTTCGCCACAGCCCCGCATCTCGTTATTCGGGTCGTTTTTGCTGTCGTGatt
ggtgctgcttctcgaacTGTGGCTCACCCCGGTACTCCCCGAGTTATTGTTGCTGTCCGAGGTGCTGGCCTTCATCGAAAGTGCCATCGACGTCGTCCTC
TCTAGATTGGGGCTGTCCGAAGCTAGAAGCTCCAGAACTTCCTCCATCATCGCTTGGTAGTTCATACTGGGGCCAAATAGTGTAGGTTGACGCCACGTAT
TGACAAGAAGTCTGGCTGAAGGGGAGTGAACGCTAAGCGAACGGCTGAAATTCTATGTGGTGCGTGCTTCGAGCGGTTGGAATCTGGGAACGGGAGTCGG
ACGTCCCAAGATGTTGAGCATAGGCAAAGGCTTCATTTCCGATTTGGTCCTCGACATTGGATTCCGGTCGTGTAATCCGCAGTCTCCCgtctcctaacgt
agttgtctctagatgtccgtggctctccgaatagcatcacggcctccgtcctaagctgttc