Description :
From Genome Similarity Track
Location :
Scaffold_18:162133- 163630
Sequence
1497 bases(100 bases per row)
AGAATGATAAGGATCAGGTGGTCTTGGGCTGAACATTGAAGAACTTGCCCACCAGGCGCTGGATCTGGTGTCCTGGGTGTTGGCTCGGGTCTCCACGAAA
CTGGATGCGCCAAGGCCCAGCTTCATCAATCTCTTGCAAGGCCTCCAGCAGGTTCGTGGGCTCTGGGCGATGGAGGTTGGGATCCTCCAAGTTGGCTTGA
CGGGATACGGATCCCGGAAGCCAAGTTACCTTATCCCCGCGTCGGGGAAGGTGCAAGAAGGATGGATCCAACAAAACATCAACGTCACACCAACCGTCCT
GGATCGCCAACACGAGGATCACGAGAACTTTCTTCCAAGCTCGGCCGGCATGACTACGTCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAGGTCGA
ACCCCGCAGTTGATTGCGAGAGATAGGGAATCGGTGAGTGCCTTCCCATATGGCAACCCGGTGCTTGGACACGAAATCCCGGAACGCGCGAACGAACAAC
CCGAGACGCCCGCGCACGTCACCCCGGAAGCTAACCGGAAGGCTTGGACGTGGATGTGGATCCCGCCTTGGACGCGGATGTGGGTCCCGCCTGCGAGGCC
GCCTTAGAGGCCGAAATCGTTTTGGGCTTGGATTTTGGGGAGGCTCGGGCGTGCTTGTGAGGACGGGGGACCCAGTGCTGGGAGCAGGAGACGCACTGCG
CGGTCGTTCCGCAGCCGACGGATCTGCCCCGCTTACAGACGGTAGAGGAGCAGAAACGCTGGCAGGAGGAGAGGGCCCAGATAGGGGAGGAAGGGGATCC
GAGACAGCAGCTGTCACCAGTGCCAGTCGTCGGTGTGCCAAATCCCGCTCCGATAAGCCACGATCGCGCTCCAGAACTAGCTGTTGCTGCTGAACATGAG
CTGCAGCGAGTTGATCCCGGAGTTTTGCTGCGGCTGTATCAGCATCTTTCAATTTGTCACCTGGATTGACATAACAGGTGAATATGGGGTTACTAGCGGG
GGACAAAAGAGGATCCACGTACTCGTGCGGCGAAGCTTGGATTCCAGCTCCGTTTGTGTTTGCTTGGCATCCGCCCACTCGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN