Description :
From Genome Similarity Track
Location :
Scaffold_46:16212- 22571
Transcript NameFunction/comments
g1936.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae
g1937.t1hypothetical protein
g1938.t1hypothetical protein

Sequence
6359 bases(100 bases per row)
TTCGAGTGCTGTAGGCGACTACAGCGCTCGCTCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGGATGT
CCTCCATCAGGACATTTCCGGGATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGA
ACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTTGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGCGGGTAGA
CGCCCCGGGTTTGGTCAACCAAACTTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTTT
TAAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTGGGGACGAGGCTCTCTGGCGCCTTGAAGCGCGTCGCCGCGCTCGA
GAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAATCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTA
TGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGACCCACTGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTT
AGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACA
GAAGCTGCTATTGTGTCTTGGACAAACCGAATTACGGCTTGTCGGCGCTGGACAAAGTCCATTGCATTCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCT
TGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTGGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCTTCGCCATGACTGCGCGCAGT
ACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCATCCCCCACTTAAGGAAGGAGCT
ACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAATT
CCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGT
CTGCGGATGATCCGCAGTCGACATGGACAGCTGTGTCCCAAGAAGTGTAAACACTTCTTGTCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACG
ATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCAACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCA
TCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTC
CGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTG
TACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACATGATCT
TGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGATCATTGTGTACACGATAACGGTGTAC
ACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAATACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCG
GCCTTCACGTCATCCGACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACGCAGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCG
AAAGCGCGTCGGCCACGATATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATAT
GTGCGTCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATAC
TTCATGGCAAGAAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGAT
CGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGGTCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGT
CAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGTGCGAATCTTGCCC
GCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCAATCTGA
CCTTTCCTGGGTCAGGACGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAG
CTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTGTGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCG
TCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGA
GCCATCCCAAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGT
ACTGAAGATCGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCA
TGAACGATGCGCCACCCGCCCTGTGGCTTCTTGACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTT
CAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAAT
ACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACTTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAG
CCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACTTCATCCTCT
CGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTCCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGC
TAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGT
GTCTGCCCGGCAGACACTGCTTTGAGAGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTTCGGAGCCCGGCTC
CGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATC
GCGCATCGCTTCTTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCC
AGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACGATCGCGTCGCCCCGGA
CGCTTCGAGACCCTCTCGAATCCGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGCTCGCTTGGGGTG
ATCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTTGCGCTG
CTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCATCCTGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGT
CCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGC
TAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCC
ACTAGAGCACGAAGAGACTTCTCTCTCTCTTCGAGCTTACCTTCCGGATGACAAGGTTCGGCTTGTCATCTTGTTTCTTGCAGTGAGATTGACTCTCACT
GTGGGCAGCGATCTTCATTGTAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGTTT
GCCCGTGGCGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGACGTAGTGACCGATGTTTCCGCAGCGGAAACA
ACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCCGACGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGT
GGCATTAGCCGTGGGGGGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACC
CTCGGAAGAGATAGATCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGAC
CAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCTTGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCA
AACGCTAGTTTGAGCTCCTCCTTGAAATCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCTTCGCTCGTCCGCCAA
GACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCC
CTCTCTTCCAACGTAACTGCTTACGTGGAGTTTCAATGACTTCACGCGCGGTGTGGCCGATGGTGACACCGAAGCTCGAGCAGTGGTTTCACGCTGTTCC
TTCACGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTT
GGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGAAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGA
GGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGAC
CCACTACTTAAGCTTGCACGTGTGCGTACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTACCCACAAGTATACTTAAACCTA
GATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTATAATGAGAGGTTCTGC
CATTGGATGGATGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTCTTGCTATGAATGTGGACC
ACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG