Description :
From Genome Similarity Track
Location :
Scaffold_209:16210- 17795
Transcript NameFunction/comments
Hyaar_Emoy2812628Amino Acid/Auxin Permease (AAAP) Family

Sequence
1585 bases(100 bases per row)
TTCTTCACGCTGGAAGATGCGAAAACATCCTTTAATCTCTTCTGTTGCGTCTGCGGCATCGGATCGCTGGCCATGCCGTCCAATTACGCTCGTGCCGGTC
CCGTATTCGCCACCGGGGCTCTCTTTTTCATGATCTTTGCCAACACGTACGCCACGCTCAAGTTGTCCAAAGTGATGCTCGTGGCACCCTCCTCAGTGCG
GACGTACGGTGACTTGGGCGAGTGGGCCCTGGGCAAGTGGGGCCGTTTCTTCACGGTAGCCTCGCAGATGGGTGTGTGCCTCCTCGTCCCTATTGCATTC
CTCATACTTGGAAGTACGATGCTGGAAGTGCTGTTTCCAGACTCGTTCAGTCAGATCTTCTGGATCACCTTCATGGCTCTTATGGTCGCCCCCGTGTGTC
TGATTCCGACACTAAAAGAGAGTTCTGGTATGGCCTTCGCCGGTTGTCTCGGCACGATCATCGCTGATATCATTGCCGTGTCTGTGTTGCAGTGGAACAT
GCGGGGCCACACTTCTGCCCCTTCTCCTGCGATTTCGGCTCATCAGGTCTTGACGTGTTTCGGGAACCTCGCACTGGCCTACGGCGCTGCAATTGTCGTC
CCTGATCTCCAACGTGAACATTCGCAGCCGCAGCGTATGCCGCGTGTCGTGTTGATCACGATCTTGTTCATCTCGGCGCTCTTCATTGTCATGGCTCTGG
CTGGCTACACTGCGGGTGGCTGCCAATTGTCCGGCAACATCCTCTACTCGATCGTGAACACGTCAGACCCCCTTGGTTTGGCTCCTCTTGGCTTCAGTGC
CGACCGTGGCGCCGTGGTGATGGCGTACTTGTTCATGCAGATCCACATCTCCATCGCCTTCTCGACGCTCATGATGCCACCGTTTTTTATAGCCGAGCGG
CTGATTCTCGGCATGCACAAGGGCCCGGATGTGGTTCAATATAACGGAGAGCTGCTGGACCAGATGAACGTCGAGATGGATCTCGAAACGCAGGAGAAGC
GCTCGTACATGCAGAGCTCGACGCCTGTGGACATGACTCACTCCCGTCAAGTCTCGGCCGCTAGTCTCGCCGAGAAAGAGTCAGGACGGATGTCGCACCT
GCGGGTCGCGCTGGAGTTCGGTGGCATCACAGCAGAAGAAGTGAACGCGCCGTACCGCAAGAACCCGCTGCGCTACGTGGCTCTGCGGCTCACGATCGTT
GGCATCCTGGTGGTCATTGCTGTGCTGGCACGCAAGCGCTTTATCGACCTCCAGGACTTCACGGGCGCCACTGCCCACACGACGAGCTGTTTGCTATTAC
CGGTGATCATCTACTGGCGAGTATGCTGGAAGTCCATGTCTATTTGGGACAAGGGGGCCTCCATGGTGGTCATTGTCGTCTGCGCCTTTGCAGGTACGTA
TGTGATGATTGATGCTGGCAAACACCTGTTCACGCCCACGGACGACCCCACGCTGTTCCCGTACTGTGACACGGAGTTCCAGGACGAACCGTACTATATC
CGTAACAACAGCAGCAGCAGCAACTAAGTCGGAGCGGGTGAGTTATCGCAGAGGAAGCTCATTGCGACGACGATGTATATCATAG