Description :
From Genome Similarity Track
Location :
Scaffold_11:16208- 20324
Sequence
4116 bases(100 bases per row)
ATCGAGACGTTGGTGCTGATGATCAGGTCCATTACCACGAGGGCGGGAATCTGTCAGCAGAAGATGTCCAAGGTGAATTAGCTGTGCTTCCTGAAATTGT
GATCTGACGACGGATGAGGTGAAGATCGATGATATCAAGGTGGGAGATCTGGAGTTCAACACCCCGGAGGAGATCGATCGGCTGCGAAAGAAGATCTGGC
ACAGGAATCACCTGCTGATCGGCAAGGGCAATGCACTTCCCCCAGCAGCCCGGGGCGTCACCTGCGACATCGACGTGGGCGACGCGAAGCCGATCGCTCC
ACGTGTCCGGAAAGTTGCCCCTCAGTTCGTGGAGAAGGTGTCCGAGCTGATCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCGTGG
GCCTCGCCGATCGTCGTGATCATCAAGAAGAACGGCGTGGATATCCGACTCTGCATCGATTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTATATC
CGATGCCCTTGATCAACGATTTGCTGGAGGATCTGGATAAGGTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGA
TCGAGCTCGTGCGATCTCGGCCTTTATCACCCACCTGGGTCTGTTCGAGTGGAACGGATGCCGTTCGGCTTGAAGAACGCTCCTCAGATCTACCAGCGAC
TTCTGGACGACGCGTTGTATGGGTTCACCAGGATCCCGCGATCGTCGGACTGTGAAGTCACTACGGACTTGATCGAGTCAGGAGAACCAGAAGATCCGGG
GCGTCCATCAGTGCTAGGTCGCAGATCGTACATTGACGACATTCTGGTGACGGCCGGGTCATGGGACGAGCTGTGTGATCGCGTGGATCACCTGCTGGAC
GCTTGTGATAAGTGGAACCTCTCGATCAGTGTGGAGAAGAGCTCTTGGGGGATGCGTAAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAG
AGGCCAATCCGAAGGATCTCACGGCTCTGACTGATCTGCCGTTCCCCGGATCGCTCCGATCGATGCAGTCATTCTTGGGCAGTCTCAATTATTACAGCCG
TTTCTTGGAAGATTACGCGATCTACGCGGTGATCCTGTACGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAACGCCCCGATCTGCGCCAGATCCTG
GATCGTCAAGTACCGAACTTAGTGGATACGGACCCAGTGAACCCCGATCGGACTCCATCAGTTCCTGAAGTCGGTGTAGCCGATGAACGCTGGATCCGTG
CTCATCGTGCCTTTTCGACCCTGAAGATGAAGATCGCGACGACACCGATCCTGCGGCACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGTATGCCAG
TGACTGGGCGATCTCGGCCGCATTGATGCAGGAGCACGACCAGATCTATCATCCCGTTACTTTCGCCAGTCGAACGCTGAAGTCGAATGACTGAATTACA
ATGTGGTGGAGAAAGAAGTGCTGGCGCTGTTACGGATCCTGGACCTGAACTATAACATGCTGGTTGGACGATCCATCCGGGTCTTGACCCGACACTCGAC
GTTGGCGTGGCTGTTCCGATCATCCGGTCTTTAAGGCCGATTGGGCCAGTGGGCTGCACTCCTATCGCCCTGGACACTGGAGATCACGAAGTACGCCAAG
GGAGAGGACGAGATATTGGGGGCGAACGCCGATAGTATTACGCCTCGATCGGATATGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGC
GGAAGATTCAAGCCCCGATCCCGACTGTGCGCGTGGATGAAGAGCTGCTGGTAATAAGTTTCGATGGATCCGCCCGCGTCAAGCGAGGCGGGGGCGCGTA
CAGTGCAATCTTGTGGAAGTTACCCGAATGGAGTGTGGTGAAGGCTCGATCGGGCTATGCTGAAGGGCTGACTGTAAACGAGGCAGAGTATCATGGTCTG
TTGTTGGGTTTCGACCTCCCTGACGGCATAGATCAAGGCAGGATAGTGGTCTGCGGTGATTCCAACCTGGTGATCCGACAAGTACGGGGCGAGATCGAAG
CAAAGCACCTAAGCTGACATTGTTGAAGCAAAAGGTGCTGGATCGACTACGGAACTGGCCAGATCACGAGCTGTTACATGTGAAACGAGACTGGAACGGA
AGTGCGGACAGCCTGGCCAGTGCAGCACTCCAACGTGAAGGGGGCGTCGTCGTCGAGGAGGATGCCGATCATGGGGATCTAGTGACACTGAACCGACTTG
ATGAGATCCTGGTCGCCCGGTCGGATGAGTCAATCGCCCGACTATCGCCGATGACGACCCGATCGGGCACCAGATCACGGCCGAACCCGACCGTCATGCA
GGAGGAGTTCGTGCGAGGGTTGCGGATCGATCGGATTCGTCGAGCACAGGATGAAGAAATGTGGATCGCGGGTATGAAGAAGTATCTGATGGGAGATGTG
GCTGATCTGACACAGGATGAGGCTCGATCCTATGGCAACCTCGCAGCGGACTACGAGATCGACGGTGATAATCTGCTGTTCTATTGCCCACCCTCCAAGC
GATCGGATGCAGATCGAGATGGACTGATGAGACTGGTAGCACCGGAGACGCTGCATCAAGACATCCTGCATCACTATCACTCCACTCTGGAAGGCGGACA
CCAGGGGACCGGGCGTACATACCAGCGGATCCGCGATCACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTATGTCGGTGAATGTGTCGACTGC
GAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCAATGGATCACATACCTTCGC
TACCCACGTCGTACAAGGGTAATACGGGACTGTTGATCTGGGTCGATCTGTTCACGGGATGCGTGATCGCGAAGGCCAGTTCCTCCCGAACGGCGCAGAC
GATCACCGAATCTTACGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGATTTATGGCTGACTTCTTCTTT
AACAAGATCCTGGGTATGCGCCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATAGTACAGACGGCGACGAGAGCCCTGA
AGATGTTCGTGGAGGATCTGGATCAGAGAGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCAACACGGCTCAAGATCGGGTCCGTGGGGACTC
CCCTGTTTATCTGGTGCATGAATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTACCCGGACTCGGGATCGGGATCCTCGACGGTGG
CGTTATCGGATCCAGAAGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGACTACGCGAGGCGATTGCGGATCGGGCCGATCGACACAATGAAGAAG
TTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGTGTGAAAGAGGGGTATGCCCGGAAGCTGGCTCACCTGTGGCACGGCCC
GTTCCGTGTGGCGGAGAAGGTGAACAAGTACACGATGAAGCTTCAGATCGCTGGTACGGACTATCACCTATTCCCGATCGTGCATTTTTCGAAGCTGAAG
TTGGTCAGGGACTTCCCCGATCGACCGCAGATCGCACTCACGGTGGACAAAGCAGATTGACTCGATTTCGACGAAGTCTTACTTCCGGAGGACAGCTGGG
CCCCAGATGGAGACTCGAACGAGTACGAAGTGGAGAAGATCACGGATACGAGAACAGGTCGCAGGACTCGGTATGGCCGGACGTATCGAGAGTTCCTGGT
ACACTGTAAGGGTTATGACGAGCCTGACTGGGTTGACGAGGCTGATCTCAACTGTGGAGCTTTGTTGCACGAGTTCCTTCGAGATCGCGTGAACCGGAAC
CGATTTGGCGCGATGCAGTCTCACGAAGAAGAGTGAGATCGGACCGCCAGGGCGAGCTGGCCGCCTTGGTGAGTGACGGATCGACGGGGAGGCCGTTGAT
CGGAGGAAGGGGTTTT