Description :
From Genome Similarity Track
Location :
contig_5:162066- 164913
Transcript NameFunction/comments
g1641.t1XP_009517314.1 hypothetical protein PHYSODRAFT_466812 [Phytophthora sojae
g1642.t1hypothetical protein

Sequence
2847 bases(100 bases per row)
AACAAGATGATCACCGCGTCCGTGGGCGTGGACTCGAGTCTGCTGCTGGAGCCTGCGCGCGAGCTACAGTTCCCGCTGCCGGACGTCACGTCGGGGCACC
GTCCGCGCTGCTGCCTCACGCTCACCAACTTGTCGCCGCTCAACGACGTGTTGTTCCGCGTACGGACCCGCAACCCGGACGCGTTCACGGTGTGTCCGAC
CCACGGGCTGCTAGCGCCAGGCACGAGCTCCAAGTGGTCATGACTGCAACTGCGCGGACCTGCGAGCGTCTGGGTGCGATGGACCCGCGGGATTTGATGA
CCCGTCAGTCTTCCGAGCTCTTCGTCGTGCAGAGTATGGAGCGAGAGAAAGAGGTGCAAACCATGCAACCGCTGGACCCGGACTCCAGCTCATCGCTGCG
GGCTTTCTGGAAGCAGATGCCGAGAGACTGCGTCACGGAGAACAAGCTGGTGTGTCGGTTCACTGCTGGTATCCCTGCGCTGGCGACCAAAGTCACACAG
GACCCCAATATGTTCTCGCGGAGTTTGAGCAACACGAGTATGAACTCGCAGGAGTACCGGTCCGGTCGCGGTGAAAACAGGAGCTTGAGTATGAGTGCGC
ACGAGTTCCGGTCGAGTCGCAGTGGAAGCAACAGCGAGTTTAGCAGACTCAATCGGTCTTTGAGCAACCAGCTAACGCCGCCGCCGGAGATGCACAGAAA
TGAACGCTGGAGCCGAAATCAATCGTTTGGTAGTGACGCCAGCTTCCACACCACAATTGAGCCCCCTATTGTGAACCGAAGGTCGGAGGCAAGAATGTCG
ACTTCGTCTAACTGGGCTGCGTCTAGAACTCCCACGACGAGGCTACGAGACAGCGCGCTAACTAGCATCAGTGTGAGCGACGGATCTGTCAGTGACACTA
TGCTGTCCGCGCAGACTTCCTTTTCCACGGACGCGGCAACGGAGGAACAGACGCACGAGCTCGGTCCACTTCAGTACCACATTCAGCCTAGTGACGTGCT
TTCGTTCAATCTCAAGCGTGCACCACGCTTCTGGGGTCAGACTTCGCTCTTCGTGGTGAACTCTAGCCAACACGACTGTCTCGCTTTTAAGGTGCGCACG
TCTAACCAATCGGGCTACGTGGTGAAGCCCAGCCGAGGGCTTGTATCGACTACGAATGCGCAGGAAGTGATCGTGTCGCTGTGTGCACCGCGCGATGAAA
ACAGTTTTGATCCCGCTAAGCGCGAGGCAAAAGATGGCTTTATGATTGAAGTCGCCAACATCTCGCGGGACAAGTACGAAGGTTTGATGAGACTGGACGA
GCGAAAACGCACCCGCGAAATGAGCTCTCTGTGGTCCCTTATGCCTCGAAGTGATCGTCGGTCGACAATGCTTTCTGTGGAGCTGAAGACTGGAGGAAGC
GATTGCGGTAGTGGCACCTGCGACAGCTCTGACAGTGGAAACTCGGACGCTCGGAGCACTGTCAACCGGAGTTCACCTGAAAAGTCTCGACAAAGTTTGC
ACTCGGTCGTGCGGGGCATGAAACAACTATCTACCTCCTCTTCAACGGATGAGTCGCCTGAGAGCGTCGCAGAGGAGAAGCCGGGATCCGCGTACGATTC
GGACGAGTCGGCGTTCACTGTCGCTCCGAGTGTCGCGCTCTCTGAGGTTGGCAAGGATGAATCTGGCAGTGATGCGGACGTGGCCTTCAGCTCGGCAGCA
AAAAGCCTGCCACGAGATCCCGCTGTGATTGTCGTCTCAGCCGACAGGATGGACACCGTCGACTTTTCCAACCCGAAGCTGTCCTTCTTTATTTAGTTGT
TACGCCGATGGGGAGCCGCGTCGAGTGTTGAAGGCTTGAAGCCTTAAGTCTTTGCTTTCATGACGTCGTAACTTCATCCCAAGGACTAGGCTATCAAAAA
TGTAGATTCGTGAAGTTTCAAAGGTTGTTTCTGCTTATTTGTAGAAAAGGTCGGTTATGCGAGTCCATTGACGGTGGCTCAGCCCCGTGTGATCTAGCTA
CTCTCTACTTGGTCACGATGTTCTCCAGGCTCTCGAGAACCTTGACAGTCGAAGACGTACCCAGCATGTTGATGATGCTAGGTGGGATGTAGCCGGCCAG
GTCGGCGTGTGCGAGGAGGGTCACGATGCAGTACACCTTGCCGTCCTCCTCCTTGAACTCCTCAATGAGATAGCCCGATATGTAGTTGTGGGCGCGCACG
TAGCCTTCCAGAGGCGCGACGTCCGCGACGTTGACAGAGCGCGTGGCAATGGCGACTCGTCCGTCTTCGAGTGTCGTGGCGTACGTGACCACGACGAACT
CGCGGCCGTAGATTGGGAACTGACCCTTGCTAGTGATCTGGCGGAAGGCCAAGTGGTTGGACTCGCCGATGTCGCGCAGCGTCACGATGCCCTCCATCAT
CTCGTCCAGCTCCAGCGTGCGGTTCGGGTCCAGCAGCACCTGCTCGATGACGCGCTTGTCGGCATCGATGCGGCGCGCGGCGCGGAACGGGCACCAGTCG
CAGTCCTCGACGGCTCCGCGCCAGATCTGCACGCCCTCGGCGTCGTCCACGAGCTCCCACGTCGTGACCTTGTCGTCACCTGAGTGGCGGTCGAGCAGAA
TCTGGATGTTCTCCTTGCCGTAGGCCTCAAAGTCCACATCGTCGGCTGTGGGGTACGCGGGCTCCTCAGGCTTGATCTGCTCCTCCGCCGCCGGCGTTTC
TCCGTACCCGAACAGGTAGTTCATACTAACTTGGTGCAAATGAAGAGGAAGGTGGCGCTGAAGAGGGGGTTTCTCGACTGACTCCGCCCACGATGGGAGC
CGCTTGACTGCTTTGACTGTTTCTGTTGCGGGGTACAGAGCGAAGCG